COP (CARD16) (NM_052889) Human Untagged Clone

CAT#: SC309071

CARD16 (untagged)-Human caspase recruitment domain family, member 16 (CARD16), transcript variant 2



  "NM_052889" in other vectors (4)

CNY 1,200.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


CARD16 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms COP; COP1; PSEUDO-ICE
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_052889 edited
ATCTGGTACCGGTCCGGAATTCCCGGGATGAGAAAAGCCATGGCCGACAAGGTCCTGAAG
GAGAAGAGAAAGCTGTTTATCCATTCCATGGGTGAAGGTACAATAAATGGCTTACTGGAT
GAATTATTACAGACAAGGGTGCTGAACCAGGAAGAGATGGAGAAAGTAAAACGTGAAAAT
GCTACAGTTATGGATAAGACCCGAGCTTTGATTGACTCCGTTATTCCGAAAGGGGCACAG
GCATGCCAAATTTGCATCACATACATTTGTGAAGAAGACAGTTACCTGGCAGAGACGCTG
GGACTCTCAGCAGGTCCGATACCTGGAAATTAG
Restriction Sites Please inquire     
ACCN NM_052889
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_052889.2, NP_443121.1
RefSeq Size 758 bp
RefSeq ORF 294 bp
Locus ID 114769
UniProt ID Q5EG05
Gene Summary Caspase inhibitor. Acts as a regulator of procaspase-1/CASP1 activation implicated in the regulation of the proteolytic maturation of pro-interleukin-1 beta (IL1B) and its release during inflammation. Inhibits the release of IL1B in response to LPS in monocytes. Also induces NF-kappa-B activation during the pro-inflammatory cytokine response. Also able to inhibit CASP1-mediated neuronal cell death, TNF-alpha, hypoxia-, UV-, and staurosporine-mediated cell death but not ER stress-mediated cell death. Acts by preventing activation of caspases CASP1 and CASP4, possibly by preventing the interaction between CASP1 and RIPK2.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) has an additional exon containing a stop codon in the middle region, as compared to variant 1. The encoded isoform (2) has a shorter and distinct C-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...