United States
Germany
Japan
United Kingdom
China
ICOS Ligand (ICOSLG) (NM_015259) Human Untagged Clone
CAT＃: SC309183
ICOSLG (untagged)-Human inducible T-cell co-stimulator ligand (ICOSLG)
CNY 3,600.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | B7-H2; B7h; B7H2; B7RP-1; B7RP1; CD275; GL50; ICOS-L; ICOSL; LICOS |
| Vector | pCMV6-XL4 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene ORF sequence for NM_015259 edited
ATGCGGCTGGGCAGTCCTGGACTGCTCTTCCTGCTCTTCAGCAGCCTTCGAGCTGATACT CAGGAGAAGGAAGTCAGAGCGATGGTAGGCAGCGACGTGGAGCTCAGCTGCGCTTGCCCT GAAGGAAGCCGTTTTGATTTAAATGATGTTTACGTATATTGGCAAACCAGTGAGTCGAAA ACCGTGGTGACCTACCACATCCCACAGAACAGCTCCTTGGAAAACGTGGACAGCCGCTAC CGGAACCGAGCCCTGATGTCACCGGCCGGCATGCTGCGGGGCGACTTCTCCCTGCGCTTG TTCAACGTCACCCCCCAGGACGAGCAGAAGTTTCACTGCCTGGTGTTGAGCCAATCCCTG GGATTCCAGGAGGTTTTGAGCGTTGAGGTTACACTGCATGTGGCAGCAAACTTCAGCGTG CCCGTCGTCAGCGCCCCCCACAGCCCCTCCCAGGATGAGCTCACCTTCACGTGTACATCC ATAAACGGCTACCCCAGGCCCAACGTGTACTGGATCAATAAGACGGACAACAGCCTGCTG GACCAGGCTCTGCAGAATGACACCGTCTTCTTGAACATGCGGGGCTTGTATGACGTGGTC AGCGTGCTGAGGATCGCACGGACCCCCAGCGTGAACATTGGCTGCTGCATAGAGAACGTG CTTCTGCAGCAGAACCTGACTGTCGGCAGCCAGACAGGAAATGACATCGGAGAGAGAGAC AAGATCACAGAGAATCCAGTCAGTACCGGCGAGAAAAACGCGGCCACGTGGAGCATCCTG GCTGTCCTGTGCCTGCTTGTGGTCGTGGCGGTGGCCATAGGCTGGGTGTGCAGGGACCGA TGCCTCCAACACAGCTATGCAGGTGCCTGGGCTGTGAGTCCGGAGACAGAGCTCACTGGC CACGTTTGA |
| Restriction Sites | NotI-NotI |
| ACCN | NM_015259 |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_015259.4, NP_056074.1 |
| RefSeq Size | 3239 bp |
| RefSeq ORF | 909 bp |
| Locus ID | 23308 |
| UniProt ID | O75144 |
| Protein Families | Transmembrane |
| Protein Pathways | Cell adhesion molecules (CAMs) |
| Gene Summary | Ligand for the T-cell-specific cell surface receptor ICOS. Acts as a costimulatory signal for T-cell proliferation and cytokine secretion; induces also B-cell proliferation and differentiation into plasma cells. Could play an important role in mediating local tissue responses to inflammatory conditions, as well as in modulating the secondary immune response by co-stimulating memory T-cell function (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longest transcript and encodes isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC208975 | ICOSLG (Myc-DDK-tagged)-Human inducible T-cell co-stimulator ligand (ICOSLG) |
CNY 3,600.00 |
|
| RC208975L1 | Lenti ORF clone of Human inducible T-cell co-stimulator ligand (ICOSLG), Myc-DDK-tagged |
CNY 6,000.00 |
|
| RC208975L2 | Lenti ORF clone of Human inducible T-cell co-stimulator ligand (ICOSLG), mGFP tagged |
CNY 6,000.00 |
|
| RC208975L3 | Lenti ORF clone of Human inducible T-cell co-stimulator ligand (ICOSLG), Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC208975L4 | Lenti ORF clone of Human inducible T-cell co-stimulator ligand (ICOSLG), mGFP tagged |
CNY 5,890.00 |
|
| RG208975 | ICOSLG (tGFP-tagged) - Human inducible T-cell co-stimulator ligand (ICOSLG) |
CNY 5,200.00 |
其它ICOS Ligand产品
