CROP (LUC7L3) (NM_016424) Human Untagged Clone
CAT#: SC310399
LUC7L3 (untagged)-Human LUC7-like 3 (S. cerevisiae) (LUC7L3), transcript variant 1
CNY 6,940.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CRA; CREAP-1; CROP; hLuc7A; LUC7A; OA48-18 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_016424, the custom clone sequence may differ by one or more nucleotides
ATGATTTCGGCCGCGCAGTTGTTGGATGAGTTAATGGGCCGGGACCGAAACCTAGCCCCG GACGAGAAGCGCAGCAACGTGCGGTGGGACCACGAGAGCGTTTGTAAATATTATCTCTGT GGTTTTTGTCCTGCGGAATTGTTCACAAATACACGTTCTGATCTTGGTCCGTGTGAAAAA ATTCATGATGAAAATCTACGAAAACAGTATGAGAAGAGCTCTCGTTTCATGAAAGTTGGC TATGAGAGAGATTTTTTGCGATACTTACAGAGCTTACTTGCAGAAGTAGAACGTAGGATC AGACGAGGCCATGCTCGTTTGGCATTATCTCAAAACCAGCAGTCTTCTGGGGCCGCTGGC CCAACAGGCAAAAATGAAGAAAAAATTCAGGTTCTAACAGACAAAATTGATGTACTTCTG CAACAGATTGAAGAATTAGGGTCTGAAGGAAAAGTAGAAGAAGCCCAGGGGATGATGAAA TTAGTTGAGCAATTAAAAGAAGAGAGAGAACTGCTAAGGTCCACAACGTCGACAATTGAA AGCTTTGCTGCACAAGAAAAACAAATGGAAGTTTGTGAAGTATGTGGAGCCTTTTTAATA GTAGGAGATGCCCAGTCCCGGGTAGATGACCATTTGATGGGAAAACAACACATGGGCTAT GCCAAAATTAAAGCTACTGTAGAAGAATTAAAAGAAAAGTTAAGGAAAAGAACCGAAGAA CCTGATCGTGATGAGCGTCTAAAAAAGGAGAAGCAAGAAAGAGAAGAAAGAGAAAAAGAA CGGGAGAGAGAAAGGGAAGAAAGAGAAAGGAAAAGACGAAGGGAAGAGGAAGAAAGAGAA AAAGAAAGGGCTCGTGACAGAGAAAGAAGAAAGAGAAGTCGTTCACGAAGTAGACACTCA AGCCGAACATCAGACAGAAGATGCAGCAGGTCTCGGGACCACAAAAGGTCACGAAGTAGA GAAAGAAGGCGGAGCAGAAGTAGAGATCGACGAAGAAGCAGAAGCCATGATCGATCAGAA AGAAAACACAGATCTCGAAGTCGGGATCGAAGAAGATCAAAAAGCCGGGATCGAAAGTCA TATAAGCACAGGAGCAAAAGTCGGGACAGAGAACAAGATAGAAAATCCAAGGAGAAAGAA AAGAGGGGATCTGATGATAAAAAAAGTAGTGTGAAGTCCGGTAGTCGAGAAAAGCAGAGT GAAGACACAAACACTGAATCGAAGGAAAGTGATACTAAGAATGAGGTCAATGGGACCAGT GAAGACATTAAATCTGAAGGTGACACTCAGTCCAATTAA |
Restriction Sites | Please inquire |
ACCN | NM_016424 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_016424.3, NP_057508.2 |
RefSeq Size | 3477 bp |
RefSeq ORF | 1299 bp |
Locus ID | 51747 |
UniProt ID | O95232 |
Domains | DUF259 |
Protein Families | Stem cell - Pluripotency |
Gene Summary | This gene encodes a protein with an N-terminal half that contains cysteine/histidine motifs and leucine zipper-like repeats, and the C-terminal half is rich in arginine and glutamate residues (RE domain) and arginine and serine residues (RS domain). This protein localizes with a speckled pattern in the nucleus, and could be involved in the formation of splicesome via the RE and RS domains. Two alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Aug 2009] Transcript Variant: This variant (1) represents the longer transcript. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC214406 | LUC7L3 (Myc-DDK-tagged)-Human LUC7-like 3 (S. cerevisiae) (LUC7L3), transcript variant 1 |
CNY 3,656.00 |
|
RC214406L3 | Lenti-ORF clone of LUC7L3 (Myc-DDK-tagged)-Human LUC7-like 3 (S. cerevisiae) (LUC7L3), transcript variant 1 |
CNY 5,890.00 |
|
RC214406L4 | Lenti-ORF clone of LUC7L3 (mGFP-tagged)-Human LUC7-like 3 (S. cerevisiae) (LUC7L3), transcript variant 1 |
CNY 5,890.00 |
|
RG214406 | LUC7L3 (tGFP-tagged) - Human LUC7-like 3 (S. cerevisiae) (LUC7L3), transcript variant 1 |
CNY 5,256.00 |