United States
Germany
Japan
United Kingdom
China
DAP3 (NM_004632) Human Untagged Clone
CAT＃: SC310440
DAP3 (untagged)-Human death associated protein 3 (DAP3), nuclear gene encoding mitochondrial protein, transcript variant 2
CNY 3,656.00
CNY 7,220.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | bMRP-10; DAP-3; MRP-S29; MRPS29; S29mt |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_004632 edited
GTCTCAGGACGGGCGCTTTGGAGCCGGCCCCAGGCAGCGTGTGTCGGTCGCCTAGTCTGG AGAACTAGTCCTCGACTCACGTGCAAGGATGATGCTGAAAGGAATAACAAGGCTTATCTC TAGGATCCATAAGTTGGACCCTGGGCGTTTTTTACACATGGGGACCCAGGCTCGCCAAAG CATTGCTGCTCACCTAGATAACCAGGTTCCAGTTGAGAGTCCGAGAGCTATTTCCCGCAC CAATGAGAATGACCCGGCCAAGCATGGGGATCAGCACGAGGGTCAGCACTACAACATCTC CCCCCAGGATTTGGAGACTGTATTTCCCCATGGCCTTCCTCCTCGCTTTGTGATGCAGGT GAAGACATTCAGTGAAGCTTGCCTGATGGTAAGGAAACCAGCCCTAGAACTTCTGCATTA CCTGAAAAACACCAGTTTTGCTTATCCAGCTATACGATATCTTCTGTATGGAGAGAAGGG AACAGGAAAAACCCTAAGTCTTTGCCATGTTATTCATTTCTGTGCAAAACAGGACTGGCT GATACTACATATTCCAGATGCTCATCTTTGGGTGAAAAATTGTCGGGATCTTCTGCAGTC CAGCTACAACAAACAGCGCTTTGATCAACCTTTAGAGGCTTCAACCTGGCTGAAGAATTT CAAAACTACAAATGAGCGCTTCCTGAACCAGATAAAAGTTCAAGAGAAGTATGTCTGGAA TAAGAGAGAAAGCACTGAGAAAGGGAGTCCTCTGGGAGAAGTGGTTGAACAGGGCATAAC ACGGGTGAGGAACGCCACAGATGCAGTTGGAATTGTGCTGAAAGAGCTAAAGAGGCAAAG TTCTTTGGGTATGTTTCACCTCCTAGTGGCCGTGGATGGAATCAATGCTCTTTGGGGAAG AACCACTCTGAAAAGAGAAGATAAAAGCCCGATTGCCCCCGAGGAATTAGCACTTGTTCA CAACTTGAGGAAAATGATGAAAAATGATTGGCATGGAGGCGCCATTGTGTCGGCTTTGAG CCAGACTGGGTCTCTCTTTAAGCCCCGGAAAGCCTATCTGCCCCAGGAGTTGCTGGGAAA GGAAGGATTTGATGCCCTGGATCCCTTTATTCCCATCCTGGTTTCCAACTATAACCCAAA GGAATTTGAAAGTTGTATTCAGTATTATTTGGAAAACAATTGGCTTCAACATGAGAAAGC TCCTACAGAAGAAGGGAAAAAAGAGCTGCTGTTCCTAAGTAACGCGAACCCCTCGCTGCT GGAGCGGCACTGTGCCTACCTCTAAGCCAAGATCACAGCATGTGAGGAAGACAGTGGACA TCTGCTTTATGCTGGACCCAGTAAGATGAGGAAGTCGGGCAGTACACAGGAAGAGGAGCC AGGCCCTTGTACCTATGGGATTGGA |
| Restriction Sites | Please inquire |
| ACCN | NM_004632 |
| Insert Size | 1400 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_004632.2, NP_004623.1 |
| RefSeq Size | 1635 bp |
| RefSeq ORF | 1197 bp |
| Locus ID | 7818 |
| UniProt ID | P51398 |
| Protein Families | Druggable Genome |
| Gene Summary | Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that also participates in apoptotic pathways which are initiated by tumor necrosis factor-alpha, Fas ligand, and gamma interferon. This protein potentially binds ATP/GTP and might be a functional partner of the mitoribosomal protein S27. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. Pseudogenes corresponding to this gene are found on chromosomes 1q and 2q. [provided by RefSeq, Dec 2010] Transcript Variant: This variant (2) encodes the longest isoform (1). Variants 1, 2 and 3 encode the same isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC219744 | DAP3 (Myc-DDK-tagged)-Human death associated protein 3 (DAP3), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 3,656.00 |
|
| RC219744L3 | Lenti ORF clone of Human death associated protein 3 (DAP3), nuclear gene encoding mitochondrial protein, transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC219744L4 | Lenti ORF clone of Human death associated protein 3 (DAP3), nuclear gene encoding mitochondrial protein, transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RG219744 | DAP3 (tGFP-tagged) - Human death associated protein 3 (DAP3), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 4,370.00 |
