Rad51L1 (RAD51B) (NM_002877) Human Untagged Clone

CAT#: SC310514

RAD51B (untagged)-Human RAD51-like 1 (S. cerevisiae) (RAD51L1), transcript variant 1



  "NM_002877" in other vectors (4)

CNY 5,700.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
RAD51L1 mouse monoclonal antibody, clone OTI7H4 (formerly 7H4)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms R51H2; RAD51L1; REC2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC310514 representing NM_002877.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGTAGCAAGAAACTAAAACGAGTGGGTTTATCACAAGAGCTGTGTGACCGTCTGAGTAGACATCAG
ATCCTTACCTGTCAGGACTTTTTATGTCTTTCCCCACTGGAGCTTATGAAGGTGACTGGTCTGAGTTAT
CGAGGTGTCCATGAACTTCTATGTATGGTCAGCAGGGCCTGTGCCCCAAAGATGCAAACGGCTTATGGG
ATAAAAGCACAAAGGTCTGCTGATTTCTCACCAGCATTCTTATCTACTACCCTTTCTGCTTTGGACGAA
GCCCTGCATGGTGGTGTGGCTTGTGGATCCCTCACAGAGATTACAGGTCCACCAGGTTGTGGAAAAACT
CAGTTTTGTATAATGATGAGCATTTTGGCTACATTACCCACCAACATGGGAGGATTAGAAGGAGCTGTG
GTGTACATTGACACAGAGTCTGCATTTAGTGCTGAAAGACTGGTTGAAATAGCAGAATCCCGTTTTCCC
AGATATTTTAACACTGAAGAAAAGTTACTTTTGACAAGTAGTAAAGTTCATCTTTATCGGGAACTCACC
TGTGATGAAGTTCTACAAAGGATTGAATCTTTGGAAGAAGAAATTATCTCAAAAGGAATTAAACTTGTG
ATTCTTGACTCTGTTGCTTCTGTGGTCAGAAAGGAGTTTGATGCACAACTTCAAGGCAATCTCAAAGAA
AGAAACAAGTTCTTGGCAAGAGAGGCATCCTCCTTGAAGTATTTGGCTGAGGAGTTTTCAATCCCAGTT
ATCTTGACGAATCAGATTACAACCCATCTGAGTGGAGCCCTGGCTTCTCAGGCAGACCTGGTGTCTCCA
GCTGATGATTTGTCCCTGTCTGAAGGCACTTCTGGATCCAGCTGTGTGATAGCCGCACTAGGAAATACC
TGGAGTCACAGTGTGAATACCCGGCTGATCCTCCAGTACCTTGATTCAGAGAGAAGACAGATTCTTATT
GCCAAGTCCCCTCTGGCTCCCTTCACCTCATTTGTCTACACCATCAAGGAGGAAGGCCTGGTTCTTCAA
GCCTATGGAAATTCCTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_002877
Insert Size 1053 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_002877.5
RefSeq Size 1888 bp
RefSeq ORF 1053 bp
Locus ID 5890
UniProt ID O15315
Domains AAA
Protein Families Druggable Genome
Protein Pathways Homologous recombination
MW 38.3 kDa
Gene Summary The protein encoded by this gene is a member of the RAD51 protein family. RAD51 family members are evolutionarily conserved proteins essential for DNA repair by homologous recombination. This protein has been shown to form a stable heterodimer with the family member RAD51C, which further interacts with the other family members, such as RAD51, XRCC2, and XRCC3. Overexpression of this gene was found to cause cell cycle G1 delay and cell apoptosis, which suggested a role of this protein in sensing DNA damage. Rearrangements between this locus and high mobility group AT-hook 2 (HMGA2, GeneID 8091) have been observed in uterine leiomyomata. [provided by RefSeq, Mar 2016]
Transcript Variant: This variant (1) has an alternate exon at the 3' end compared to the longest variant (3). The resulting isoform (1) has a distinct C-terminus, as compared to isoform 3.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...