Bcl G (BCL2L14) (NM_030766) Human Untagged Clone

CAT#: SC310598

BCL2L14 (untagged)-Human BCL2-like 14 (apoptosis facilitator) (BCL2L14), transcript variant 2



  "NM_030766" in other vectors (6)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
BCL2L14 mouse monoclonal antibody,clone OTI6D1
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BCLG
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC310598 representing NM_030766.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTGTAGCACCAGTGGGTGTGACCTGGAAGAAATCCCCCTAGATGATGATGACCTAAACACCATAGAA
TTCAAAATCCTCGCCTACTACACCAGACATCATGTCTTCAAGAGCACCCCTGCTCTCTTCTCACCAAAG
CTGCTGAGAACAAGAAGTTTGTCCCAGAGGGGCCTGGGGAATTGTTCAGCAAATGAGTCATGGACAGAG
GTGTCATGGCCTTGCAGAAATTCCCAATCCAGTGAGAAGGCCATAAACCTTGGCAAGAAAAAGTCTTCT
TGGAAAGCATTCTTTGGAGTAGTGGAGAAGGAAGATTCGCAGAGCACGCCTGCCAAGGTCTCTGCTCAG
GGTCAAAGGACGTTGGAATACCAAGATTCGCACAGCCAGCAGTGGTCCAGGTGTCTTTCTAACGTGGAG
CAGTGCTTGGAGCATGAAGCTGTGGACCCCAAAGTCATTTCCATTGCCAACCGAGTAGCTGAAATTGTT
TACTCCTGGCCACCACCACAAGCGACCCAGGCAGGAGGCTTCAAGTCCAAAGAGATTTTTGTAACTGAG
GGTCTCTCCTTCCAGCTCCAAGGCCACGTGCCTGTAGCTTCAAGTTCTAAGAAAGATGAAGAAGAACAA
ATACTAGCCAAAATTGTTGAGCTGCTGAAATATTCAGGAGATCAGTTGGAAAGAAAGGACACTGCCTTC
ATCCCCATTCCCTTGGTTGACACCAGCATCCAGGGTTTTCCACAGGATGGTTTGATGGCCTGCATTTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_030766
Insert Size 759 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_030766.1
RefSeq Size 2039 bp
RefSeq ORF 759 bp
Locus ID 79370
UniProt ID Q9BZR8
Protein Families Druggable Genome
MW 28.1 kDa
Gene Summary The protein encoded by this gene belongs to the BCL2 protein family. BCL2 family members form hetero- or homodimers and act as anti- or pro-apoptotic regulators that are involved in a wide variety of cellular activities. Overexpression of this gene has been shown to induce apoptosis in cells. Three alternatively spliced transcript variants encoding two distinct isoforms have been reported for this gene. [provided by RefSeq, May 2009]
Transcript Variant: This variant (2) is also known as BCL-G short form. It contains an extra segment within the coding region, which results in a frameshift, when compared to variant 1. This variant encodes an isoform (2) that contains a shorter and distinct C terminus, as compared to isoform 1. CCDS Note: This CCDS ID is based on AF281255.1. This transcript appears to be a nonsense-mediated mRNA decay (NMD) candidate; however, there are publications describing this transcript and its encoded protein (Guo et al, 2001, PMID 11054413; Liu et al, 2008, PMID 18006276) so this CCDS ID has been retained.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...