United States
Germany
Japan
United Kingdom
China
PEAMT (PEMT) (NM_148172) Human Untagged Clone
CAT＃: SC310611
PEMT (untagged)-Human phosphatidylethanolamine N-methyltransferase (PEMT), nuclear gene encoding mitochondrial protein, transcript variant 1
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | PEAMT; PEMPT; PEMT2; PLMT; PNMT |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC310611 representing NM_148172.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAAGAGATCTGGGAACCCGGGAGCCGAGGTAACGAACAGCTCGGTGGCAGGGCCTGACTGCTGCGGA GGCCTCGGCAATATTGATTTTAGACAGGCAGACTTCTGCGTTATGACCCGGCTGCTGGGCTACGTGGAC CCCCTGGATCCCAGCTTTGTGGCTGCCGTCATCACCATCACCTTCAATCCGCTCTACTGGAATGTGGTT GCACGATGGGAACACAAGACCCGCAAGCTGAGCAGGGCCTTCGGATCCCCCTACCTGGCCTGCTACTCT CTAAGCGTCACCATCCTGCTCCTGAACTTCCTGCGCTCGCACTGCTTCACGCAGGCCATGCTGAGCCAG CCCAGGATGGAGAGCCTGGACACCCCCGCGGCCTACAGCCTGGGCCTCGCGCTCCTGGGACTGGGCGTC GTGCTCGTGCTCTCCAGCTTCTTTGCACTGGGGTTCGCTGGAACTTTCCTAGGTGATTACTTCGGGATC CTCAAGGAGGCGAGAGTGACCGTGTTCCCCTTCAACATCCTGGACAACCCCATGTACTGGGGAAGCACA GCCAACTACCTGGGCTGGGCCATCATGCACGCCAGCCCCACGGGCCTGCTCCTGACGGTGCTGGTGGCC CTCACCTACATAGTGGCTCTCCTATACGAAGAGCCCTTCACCGCTGAGATCTACCGGCAGAAAGCCTCC GGGTCCCACAAGAGGAGCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_148172 |
| Insert Size | 711 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_148172.2 |
| RefSeq Size | 1026 bp |
| RefSeq ORF | 711 bp |
| Locus ID | 10400 |
| UniProt ID | Q9UBM1 |
| Domains | PEMT |
| Protein Families | Transmembrane |
| Protein Pathways | Glycerophospholipid metabolism, Metabolic pathways |
| MW | 25.9 kDa |
| Gene Summary | Phosphatidylcholine (PC) is the most abundant mammalian phospholipid. This gene encodes an enzyme which converts phosphatidylethanolamine to phosphatidylcholine by sequential methylation in the liver. Another distinct synthetic pathway in nucleated cells converts intracellular choline to phosphatidylcholine by a three-step process. The protein isoforms encoded by this gene localize to the endoplasmic reticulum and mitochondria-associated membranes. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2012] Transcript Variant: This variant (1) encodes the longest isoform (1). Isoform 1 localizes to the endoplasmic reticulum. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC220492 | PEMT (Myc-DDK-tagged)-Human phosphatidylethanolamine N-methyltransferase (PEMT), nuclear gene encoding mitochondrial protein, transcript variant 1 |
CNY 2,400.00 |
|
| RC220492L1 | Lenti ORF clone of Human phosphatidylethanolamine N-methyltransferase (PEMT), nuclear gene encoding mitochondrial protein, transcript variant 1, Myc-DDK-tagged |
CNY 4,800.00 |
|
| RC220492L2 | Lenti ORF clone of Human phosphatidylethanolamine N-methyltransferase (PEMT), nuclear gene encoding mitochondrial protein, transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
| RC220492L3 | Lenti ORF clone of Human phosphatidylethanolamine N-methyltransferase (PEMT), nuclear gene encoding mitochondrial protein, transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC220492L4 | Lenti ORF clone of Human phosphatidylethanolamine N-methyltransferase (PEMT), nuclear gene encoding mitochondrial protein, transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
| RG220492 | PEMT (tGFP-tagged) - Human phosphatidylethanolamine N-methyltransferase (PEMT), nuclear gene encoding mitochondrial protein, transcript variant 1 |
CNY 4,000.00 |
