Placental lactogen (CSH2) (NM_020991) Human Untagged Clone

CAT#: SC310620

CSH2 (untagged)-Human chorionic somatomammotropin hormone 2 (CSH2), transcript variant 1



  "NM_020991" in other vectors (5)

CNY 3,990.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-CSH2 Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CS-2; CSB; GHB1; hCS-B; PL
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_020991, the custom clone sequence may differ by one or more nucleotides
ATGGCTGCAGGCTCCCGGACGTCCCTGCTCCTGGCTTTTGCCCTGCTCTGCCTGCCCTGG
CTTCAAGAGGCTGGTGCCGTCCAAACCGTTCCGTTATCCAGGCTTTTTGACCACGCTATG
CTCCAAGCCCATCGCGCGCACCAGCTGGCCATTGACACCTACCAGGAGTTTGAAGAAACC
TATATCCCAAAGGACCAGAAGTATTCATTCCTGCATGACTCCCAGACCTCCTTCTGCTTC
TCAGACTCTATTCCGACACCCTCCAACATGGAGGAAACGCAACAGAAATCCAATCTAGAG
CTGCTCCGCATCTCCCTGCTGCTCATCGAGTCGTGGCTGGAGCCCGTGCGGTTCCTCAGG
AGTATGTTCGCCAACAACCTGGTGTATGACACCTCGGACAGCGATGACTATCACCTCCTA
AAGGACCTAGAGGAAGGCATCCAAACGCTGATGGGGAGGCTGGAAGACGGCAGCCGCCGG
ACTGGGCAGATCCTCAAGCAGACCTACAGCAAGTTTGACACAAACTCACACAACCATGAC
GCACTGCTCAAGAACTACGGGCTGCTCTACTGCTTCAGGAAGGACATGGACAAGGTCGAG
ACATTCCTGCGCATGGTGCAGTGCCGCTCTGTAGAGGGTAGCTGTGGCTTCTAG
Restriction Sites Please inquire     
ACCN NM_020991
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_020991.3, NP_066271.1
RefSeq Size 883 bp
RefSeq ORF 654 bp
Locus ID 1443
UniProt ID P01243
Protein Families Secreted Protein
Gene Summary The protein encoded by this gene is a member of the somatotropin/prolactin family of hormones and plays an important role in growth control. The gene is located at the growth hormone locus on chromosome 17 along with four other related genes in the same transcriptional orientation; an arrangement which is thought to have evolved by a series of gene duplications. Although the five genes share a remarkably high degree of sequence identity, they are expressed selectively in different tissues. Alternative splicing generates additional isoforms of each of the five growth hormones. This particular family member is expressed mainly in the placenta and utilizes multiple transcription initiation sites. Expression of the identical mature proteins for chorionic somatomammotropin hormones 1 and 2 is upregulated during development, while the ratio of 1 to 2 increases by term. Structural and expression differences provide avenues for developmental regulation and tissue specificity. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) utilizes all five exons, resulting in the longest, most abundant isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...