RBPMS (NM_006867) Human Untagged Clone
CAT#: SC310634
RBPMS (untagged)-Human RNA binding protein with multiple splicing (RBPMS), transcript variant 4
CNY 2,400.00
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | HERMES |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_006867 edited
CGCCCGAGGGAGCCCCGGCGCCCGGGGAAGGCTCCAGTGGGCTAGCGCGCCCTCGCCCAG CCCCGCGCCCCAGCCCTGCCCGGCCCGGCGAGGAAGGACCGGGAAGATGAACAACGGCGG CAAAGCCGAGAAGGAGAACACCCCGAGCGAGGCCAACCTTCAGGAGGAGGAGGTCCGGAC CCTATTTGTCAGTGGCCTTCCTCTGGATATCAAACCTCGGGAGCTCTATCTGCTTTTCAG ACCATTTAAGGGCTATGAGGGTTCTCTTATAAAGCTCACATCTAAACAGCCTGTAGGTTT TGTCAGTTTTGACAGTCGCTCAGAAGCAGAGGCTGCAAAGAATGCTTTGAATGGCATCCG CTTCGATCCTGAAATTCCGCAAACACTACGACTAGAGTTTGCTAAGGCAAACACGAAGAT GGCCAAGAACAAACTCGTAGGGACTCCAAACCCCAGTACTCCTCTGCCCAACACTGTACC TCAGTTCATTGCCAGAGAGCCATATGAGCTCACAGTGCCTGCACTTTACCCCAGTAGCCC TGAAGTGTGGGCCCCGTACCCTCTGTACCCAGCGGAGTTAGCGCCTGCTCTACCTCCTCC TGCTTTCACCTATCCCGCTTCACTGCATGCCCAGATGCGCTGGCTCCCTCCCTCCGAGGC TACTTCTCAGGGCTGGAAGTCCCGTCAGTTCTGCTGA |
Restriction Sites | Please inquire |
ACCN | NM_006867 |
Insert Size | 800 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_006867.2, NP_006858.1 |
RefSeq Size | 3154 bp |
RefSeq ORF | 591 bp |
Locus ID | 11030 |
UniProt ID | Q93062 |
Domains | RRM |
Protein Families | Stem cell - Pluripotency |
Gene Summary | This gene encodes a member of the RNA recognition motif family of RNA-binding proteins. The RNA recognition motif is between 80-100 amino acids in length and family members contain one to four copies of the motif. The RNA recognition motif consists of two short stretches of conserved sequence, as well as a few highly conserved hydrophobic residues. The encoded protein has a single, putative RNA recognition motif in its N-terminus. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jun 2013] Transcript Variant: This variant (4) includes an alternate exon in the 3' UTR compared to variant 1. Variants 1 and 4 encode the same isoform (A). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC220089 | RBPMS (Myc-DDK-tagged)-Human RNA binding protein with multiple splicing (RBPMS), transcript variant 4 |
CNY 2,400.00 |
|
RC220089L3 | Lenti-ORF clone of RBPMS (Myc-DDK-tagged)-Human RNA binding protein with multiple splicing (RBPMS), transcript variant 4 |
CNY 5,890.00 |
|
RC220089L4 | Lenti-ORF clone of RBPMS (mGFP-tagged)-Human RNA binding protein with multiple splicing (RBPMS), transcript variant 4 |
CNY 5,890.00 |
|
RG220089 | RBPMS (tGFP-tagged) - Human RNA binding protein with multiple splicing (RBPMS), transcript variant 4 |
CNY 4,370.00 |