FGF5 (NM_033143) Human Untagged Clone
CAT#: SC310682
FGF5 (untagged)-Human fibroblast growth factor 5 (FGF5), transcript variant 2
CNY 1,320.00
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | HBGF-5; Smag-82; TCMGLY |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC310682 representing NM_033143.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAGCTTGTCCTTCCTCCTCCTCCTCTTCTTCAGCCACCTGATCCTCAGCGCCTGGGCTCACGGGGAG AAGCGTCTCGCCCCCAAAGGGCAACCCGGACCCGCTGCCACTGATAGGAACCCTAGAGGCTCCAGCAGC AGACAGAGCAGCAGTAGCGCTATGTCTTCCTCTTCTGCCTCCTCCTCCCCCGCAGCTTCTCTGGGCAGC CAAGGAAGTGGCTTGGAGCAGAGCAGTTTCCAGTGGAGCCCCTCGGGGCGCCGGACCGGCAGCCTCTAC TGCAGAGTGGGCATCGGTTTCCATCTGCAGATCTACCCGGATGGCAAAGTCAATGGATCCCACGAAGCC AATATGTTAAGCCAAGTTCACAGATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_033143 |
Insert Size | 372 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_033143.2 |
RefSeq Size | 5295 bp |
RefSeq ORF | 372 bp |
Locus ID | 2250 |
UniProt ID | P12034 |
Protein Families | Druggable Genome, Secreted Protein |
Protein Pathways | MAPK signaling pathway, Melanoma, Pathways in cancer, Regulation of actin cytoskeleton |
MW | 13 kDa |
Gene Summary | The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. This gene was identified as an oncogene, which confers transforming potential when transfected into mammalian cells. Targeted disruption of the homolog of this gene in mouse resulted in the phenotype of abnormally long hair, which suggested a function as an inhibitor of hair elongation. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) lacks an exon in the coding region, which results in a frameshift and an early stop codon, compared to variant 1. The encoded isoform (2, also referred to as 'FGF-5S' or 'short isoform') is shorter and has a distinct C-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC216267 | FGF5 (Myc-DDK-tagged)-Human fibroblast growth factor 5 (FGF5), transcript variant 2 |
CNY 1,200.00 |
|
RC216267L3 | Lenti ORF clone of Human fibroblast growth factor 5 (FGF5), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC216267L4 | Lenti ORF clone of Human fibroblast growth factor 5 (FGF5), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG216267 | FGF5 (tGFP-tagged) - Human fibroblast growth factor 5 (FGF5), transcript variant 2 |
CNY 2,800.00 |