CD83 (NM_001040280) Human Untagged Clone
CAT#: SC310981
CD83 (untagged)-Human CD83 molecule (CD83), transcript variant 2
CNY 2,400.00
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | BL11; HB15 |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_001040280 edited
ATGTCGCGCGGCCTCCAGCTTCTGCTCCTGAGCTGCGCCTACAGCCTGGCTCCCGCGACG CCGGAGGTGAAGGTGGCTTGCTCCGAAGATGTGGACTTGCCCTGCACCGCCCCCTGGGAT CCGCAGGTTCCCTACACGGTCTCCTGGGTCAAGTTATTGGAGGGTGGTGAAGAGAGGATG GAGACACCCCAGGAAGACCACCTCAGAGGACAGCACTATCATCAGAAGGGGCAAAATGGT TCTTTCGACGCCCCCAATGAAAGGCCCTATTCCCTGAAGATCCGAAACACTACCAGCTGC AACTCGGGGACATACAGGTGCACTCTGCAGGACCCGGATGGGCAGAGAAACCTAAGTGGC AAGGTGATCTTGAGAGTGACAGGATGCCCTGCACAGCGTAAAGAAGAGACTTTTAAGAAA TACAGAGCGGAGATTGTCCTGCTGCTGGCTCTGGTTATTTTCTACTTAACACTCATCATT TTCACTTGTTTTGCACGGCTACAGAGTATCTTCCCAGATTTTTCTAAAGCTGGCATGGAA CGAGCTTTTCTCCCAGTTACCTCCCCAAATAAGCATTTAGGGCTAGTGACTCCTCACAAG ACAGAACTGGTATGA |
Restriction Sites | Please inquire |
ACCN | NM_001040280 |
Insert Size | 2100 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001040280.1, NP_001035370.1 |
RefSeq Size | 2475 bp |
RefSeq ORF | 615 bp |
Locus ID | 9308 |
UniProt ID | Q01151 |
Protein Families | Transmembrane |
Gene Summary | The protein encoded by this gene is a single-pass type I membrane protein and member of the immunoglobulin superfamily of receptors. The encoded protein may be involved in the regulation of antigen presentation. A soluble form of this protein can bind to dendritic cells and inhibit their maturation. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011] Transcript Variant: This variant (2) uses an alternate in-frame splice junction at the 5' end of an exon compared to variant 1. The resulting isoform (b) has the same N- and C-termini but is 1 aa shorter compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC212520 | CD83 (Myc-DDK-tagged)-Human CD83 molecule (CD83), transcript variant 2 |
CNY 2,400.00 |
|
RC212520L3 | Lenti ORF clone of Human CD83 molecule (CD83), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC212520L4 | Lenti ORF clone of Human CD83 molecule (CD83), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG212520 | CD83 (tGFP-tagged) - Human CD83 molecule (CD83), transcript variant 2 |
CNY 4,000.00 |