NCBP2 (NM_001042540) Human Untagged Clone
CAT#: SC311340
NCBP2 (untagged)-Human nuclear cap binding protein subunit 2, 20kDa (NCBP2), transcript variant 2
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CBC2; CBP20; NIP1; PIG55 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001042540, the custom clone sequence may differ by one or more nucleotides
ATGTCGGGTGGCCTCCTGAAGGCGCTGCGCAGCGACTCCTACGTGGAGCTGAGCCAGTAC CGGGACCAGCACTTCCGGGGTGACAATGAAGAACAAGAAAAATTACTGAAGAAAAGCTAT GCGGAAAACGCCATGCGGTACATAAATGGGACGCGTCTGGATGACCGAATCATTCGCACA GACTGGGACGCAGGCTTTAAGGAGGGCAGGCAATACGGCCGTGGGCGATCTGGGGGCCAG GTTCGGGATGAGTATCGGCAGGACTACGATGCTGGGAGAGGAGGCTATGGAAAACTGGCA CAGAACCAGTGA |
Restriction Sites | Please inquire |
ACCN | NM_001042540 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001042540.1, NP_001036005.1 |
RefSeq Size | 2016 bp |
RefSeq ORF | 312 bp |
Locus ID | 22916 |
UniProt ID | P52298 |
Protein Families | Druggable Genome |
Protein Pathways | Spliceosome |
Gene Summary | The product of this gene is a component of the nuclear cap-binding protein complex (CBC), which binds to the monomethylated 5' cap of nascent pre-mRNA in the nucleoplasm. The encoded protein has an RNP domain commonly found in RNA binding proteins, and contains the cap-binding activity. The CBC promotes pre-mRNA splicing, 3'-end processing, RNA nuclear export, and nonsense-mediated mRNA decay. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 5' coding region, compared to variant 1. The encoded isoform (2) is shorter compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC221605 | NCBP2 (Myc-DDK-tagged)-Human nuclear cap binding protein subunit 2, 20kDa (NCBP2), transcript variant 2 |
CNY 1,200.00 |
|
RC221605L1 | Lenti-ORF clone of NCBP2 (Myc-DDK-tagged)-Human nuclear cap binding protein subunit 2, 20kDa (NCBP2), transcript variant 2 |
CNY 3,600.00 |
|
RC221605L2 | Lenti-ORF clone of NCBP2 (mGFP-tagged)-Human nuclear cap binding protein subunit 2, 20kDa (NCBP2), transcript variant 2 |
CNY 5,890.00 |
|
RC221605L3 | Lenti-ORF clone of NCBP2 (Myc-DDK-tagged)-Human nuclear cap binding protein subunit 2, 20kDa (NCBP2), transcript variant 2 |
CNY 5,890.00 |
|
RC221605L4 | Lenti-ORF clone of NCBP2 (mGFP-tagged)-Human nuclear cap binding protein subunit 2, 20kDa (NCBP2), transcript variant 2 |
CNY 5,890.00 |
|
RG221605 | NCBP2 (tGFP-tagged) - Human nuclear cap binding protein subunit 2, 20kDa (NCBP2), transcript variant 2 |
CNY 4,370.00 |