PSAP (NM_001042465) Human Untagged Clone
CAT#: SC311394
PSAP (untagged)-Human prosaposin (PSAP), transcript variant 2
CNY 6,288.00
Cited in 1 publication. |
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | GLBA; SAP1; SAP2 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001042465, the custom clone sequence may differ by one or more nucleotides
ATGTACGCCCTCTTCCTCCTGGCCAGCCTCCTGGGCGCGGCTCTAGCCGGCCCGGTCCTT GGACTGAAAGAATGCACCAGGGGCTCGGCAGTGTGGTGCCAGAATGTGAAGACGGCGTCC GACTGCGGGGCAGTGAAGCACTGCCTGCAGACCGTTTGGAACAAGCCAACAGTGAAATCC CTTCCCTGCGACATATGCAAAGACGTTGTCACCGCAGCTGGTGATATGCTGAAGGACAAT GCCACTGAGGAGGAGATCCTTGTTTACTTGGAGAAGACCTGTGACTGGCTTCCGAAACCG AACATGTCTGCTTCATGCAAGGAGATAGTGGACTCCTACCTCCCTGTCATCCTGGACATC ATTAAAGGAGAAATGAGCCGTCCTGGGGAGGTGTGCTCTGCTCTCAACCTCTGCGAGTCT CTCCAGAAGCACCTAGCAGAGCTGAATCACCAGAAGCAGCTGGAGTCCAATAAGATCCCA GAGCTGGACATGACTGAGGTGGTGGCCCCCTTCATGGCCAACATCCCTCTCCTCCTCTAC CCTCAGGACGGCCCCCGCAGCAAGCCCCAGCCAAAGGATAATGGGGACGTTTGCCAGGAC TGCATTCAGATGGTGACTGACATCCAGACTGCTGTACGGACCAACTCCACCTTTGTCCAG GCCTTGGTGGAACATGTCAAGGAGGAGTGTGACCGCCTGGGCCCTGGCATGGCCGACATA TGCAAGAACTATATCAGCCAGTATTCTGAAATTGCTATCCAGATGATGATGCACATGCAG GATCAGCAACCCAAGGAGATCTGTGCGCTGGTTGGGTTCTGTGATGAGGTGAAAGAGATG CCCATGCAGACTCTGGTCCCCGCCAAAGTGGCCTCCAAGAATGTCATCCCTGCCCTGGAA CTGGTGGAGCCCATTAAGAAGCACGAGGTCCCAGCAAAGTCTGATGTTTACTGTGAGGTG TGTGAATTCCTGGTGAAGGAGGTGACCAAGCTGATTGACAACAACAAGACTGAGAAAGAA ATACTCGACGCTTTTGACAAAATGTGCTCGAAGCTGCCGAAGTCCCTGTCGGAAGAGTGC CAGGAGGTGGTGGACACGTACGGCAGCTCCATCCTGTCCATCCTGCTGGAGGAGGTCAGC CCTGAGCTGGTGTGCAGCATGCTGCACCTCTGCTCTGGCACGCGGCTGCCTGCACTGACC GTTCACGTGACTCAGCCAAAGGACGGTGGCTTCTGCGAAGTGTGCAAGAAGCTGGTGGGT TATTTGGATCGCAACCTGGAGAAAAACAGCACCAAGCAGGAGATCCTGGCTGCTCTTGAG AAAGGCTGCAGCTTCCTGCCAGACCCTTACCAGAAGCAGTGTGATCAGTTTGTGGCAGAG TACGAGCCCGTGCTGATCGAGATCCTGGTGGAGGTGATGGATCCTTCCTTCGTGTGCTTG AAAATTGGAGCCTGCCCCTCGGCCCATAAGCCCTTGTTGGGAACTGAGAAGTGTATATGG GGCCCAAGCTACTGGTGCCAGAACACAGAGACAGCAGCCCAGTGCAATGCTGTCGAGCAT TGCAAACGCCATGTGTGGAACTAG |
Restriction Sites | Please inquire |
ACCN | NM_001042465 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001042465.1, NP_001035930.1 |
RefSeq Size | 2848 bp |
RefSeq ORF | 1584 bp |
Locus ID | 5660 |
UniProt ID | P07602 |
Protein Families | Druggable Genome |
Protein Pathways | Lysosome |
Gene Summary | This gene encodes a highly conserved preproprotein that is proteolytically processed to generate four main cleavage products including saposins A, B, C, and D. Each domain of the precursor protein is approximately 80 amino acid residues long with nearly identical placement of cysteine residues and glycosylation sites. Saposins A-D localize primarily to the lysosomal compartment where they facilitate the catabolism of glycosphingolipids with short oligosaccharide groups. The precursor protein exists both as a secretory protein and as an integral membrane protein and has neurotrophic activities. Mutations in this gene have been associated with Gaucher disease and metachromatic leukodystrophy. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Feb 2016] Transcript Variant: This variant (2) represents the longest transcript and encodes the longest isoform (b). |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
Prosaposin is a regulator of progranulin levels and oligomerization
,Nicholson, AM;Finch, NA;Almeida, M;Perkerson, RB;van Blitterswijk, M;Wojtas, A;Cenik, B;Rotondo, S;Inskeep, V;Almasy, L;Dyer, T;Peralta, J;Jun, G;Wood, AR;Frayling, TM;Fuchsberger, C;Fowler, S;Teslovich, TM;Manning, AK;Kumar, S;Curran, J;Lehman, D;Abecasis, G;Duggirala, R;Pottier, C;Zahir, HA;Crook, JE;Karydas, A;Mitic, L;Sun, Y;Dickson, DW;Bu, G;Herz, J;Yu, G;Miller, BL;Ferguson, S;Petersen, RC;Graff-Radford, N;Blangero, J;Rademakers, R;,
Nat Commun
,PubMed ID 27356620
[PSAP]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC212986 | PSAP (Myc-DDK-tagged)-Human prosaposin (PSAP), transcript variant 2 |
CNY 5,888.00 |
|
RC212986L1 | Lenti-ORF clone of PSAP (Myc-DDK-tagged)-Human prosaposin (PSAP), transcript variant 2 |
CNY 8,288.00 |
|
RC212986L2 | Lenti-ORF clone of PSAP (mGFP-tagged)-Human prosaposin (PSAP), transcript variant 2 |
CNY 5,890.00 |
|
RC212986L3 | Lenti-ORF clone of PSAP (Myc-DDK-tagged)-Human prosaposin (PSAP), transcript variant 2 |
CNY 5,890.00 |
|
RC212986L4 | Lenti-ORF clone of PSAP (mGFP-tagged)-Human prosaposin (PSAP), transcript variant 2 |
CNY 5,890.00 |
|
RG212986 | PSAP (tGFP-tagged) - Human prosaposin (PSAP), transcript variant 2 |
CNY 4,370.00 |