Caspase 2 (CASP2) (NM_032983) Human Untagged Clone
CAT#: SC311729
CASP2 (untagged)-Human caspase 2, apoptosis-related cysteine peptidase (CASP2), transcript variant 3
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CASP-2; ICH1; NEDD-2; NEDD2; PPP1R57 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_032983, the custom clone sequence may differ by one or more nucleotides
ATGGCGGCGCCGAGCGCGGGGTCTTGGTCCACCTTCCAGCACAAGGAGCTGATGGCCGCT GACAGGGGACGCAGGATATTGGGAGTGTGTGGCATGCATCCTCATCATCAGGAAACTCTA AAAAAGAACCGAGTGGTGCTAGCCAAACAGCTGTTGTTGAGCGAATTGTTAGAACATCTT CTGGAGAAGGACATCATCACCTTGGAAATGAGGGAGCTCATCCAGGCCAAAGTGGGCAGT TTCAGCCAGAATGTGGAACTCCTCAACTTGCTGCCTAAGAGGGGTCCCCAAGCTTTTGAT GCCTTCTGTGAAGCCTTGCACTCC |
Restriction Sites | Please inquire |
ACCN | NM_032983 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_032983.2, NP_116765.2 |
RefSeq Size | 3927 bp |
RefSeq ORF | 327 bp |
Locus ID | 835 |
UniProt ID | P42575 |
Protein Families | Druggable Genome, Protease |
Gene Summary | This gene encodes a member of the cysteine-aspartic acid protease (caspase) family. Caspases mediate cellular apoptosis through the proteolytic cleavage of specific protein substrates. The encoded protein may function in stress-induced cell death pathways, cell cycle maintenance, and the suppression of tumorigenesis. Increased expression of this gene may play a role in neurodegenerative disorders including Alzheimer's disease, Huntington's disease and temporal lobe epilepsy. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011] Transcript Variant: This variant (3) lacks an exon and uses an alternate splice site in the coding region, which results in a frameshift and early stop codon, compared to variant 1. The encoded isoform (3) is shorter and has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC213955 | CASP2 (Myc-DDK-tagged)-Human caspase 2, apoptosis-related cysteine peptidase (CASP2), transcript variant 3 |
CNY 3,990.00 |
|
RC213955L3 | Lenti-ORF clone of CASP2 (Myc-DDK-tagged)-Human caspase 2, apoptosis-related cysteine peptidase (CASP2), transcript variant 3 |
CNY 5,890.00 |
|
RC213955L4 | Lenti-ORF clone of CASP2 (mGFP-tagged)-Human caspase 2, apoptosis-related cysteine peptidase (CASP2), transcript variant 3 |
CNY 5,890.00 |
|
RG213955 | CASP2 (tGFP-tagged) - Human caspase 2, apoptosis-related cysteine peptidase (CASP2), transcript variant 3 |
CNY 4,370.00 |