UBE2V1 (NM_021988) Human Untagged Clone
CAT#: SC312300
UBE2V1 (untagged)-Human ubiquitin-conjugating enzyme E2 variant 1 (UBE2V1), transcript variant 1
CNY 6,208.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CIR1; CROC-1; CROC1; UBE2V; UEV-1; UEV1; UEV1A |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_021988 edited
ATGCCAGGAGAGGTTCAAGCGTCTTACCTGAAGTCACAAAGCAAACTGAGTGATGAAGGA AGACTTGAACCTAGAAAATTTCACTGCAAAGGAGTAAAAGTCCCTCGCAATTTCCGACTG TTGGAAGAACTCGAAGAAGGCCAGAAAGGAGTAGGAGATGGCACAGTTAGCTGGGGTCTA GAAGATGACGAAGACATGACACTTACAAGATGGACAGGGATGATAATTGGGCCTCCAAGA ACAATTTATGAAAACCGAATATACAGCCTTAAAATAGAATGTGGACCTAAATACCCAGAA GCACCCCCCTTTGTAAGATTTGTAACAAAAATTAATATGAATGGAGTAAATAGTTCTAAT GGAGTGGTGGACCCAAGAGCCATATCAGTGCTAGCAAAATGGCAGAATTCATATAGCATC AAAGTTGTCCTGCAAGAGCTTCGGCGCCTAATGATGTCTAAAGAAAATATGAAACTCCCT CAGCCGCCCGAAGGACAGTGTTACAGCAATTAA |
Restriction Sites | Please inquire |
ACCN | NM_021988 |
Insert Size | 2500 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_021988.3. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_021988.3, NP_068823.2 |
RefSeq Size | 2554 bp |
RefSeq ORF | 2541 bp |
Locus ID | 7335 |
UniProt ID | Q13404 |
Domains | UBCc |
Protein Families | Druggable Genome, Transcription Factors |
Gene Summary | Ubiquitin-conjugating E2 enzyme variant proteins constitute a distinct subfamily within the E2 protein family. They have sequence similarity to other ubiquitin-conjugating enzymes but lack the conserved cysteine residue that is critical for the catalytic activity of E2s. The protein encoded by this gene is located in the nucleus and can cause transcriptional activation of the human FOS proto-oncogene. It is thought to be involved in the control of differentiation by altering cell cycle behavior. Alternatively spliced transcript variants encoding multiple isoforms have been described for this gene, and multiple pseudogenes of this gene have been identified. Co-transcription of this gene and the neighboring upstream gene generates a rare transcript (Kua-UEV), which encodes a fusion protein comprised of sequence sharing identity with each individual gene product. [provided by RefSeq, Apr 2012] Transcript Variant: This variant (1) encodes the longest isoform (a). Variants 1, 2 and 5 encode the same isoform. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC216178 | UBE2V1 (Myc-DDK-tagged)-Human ubiquitin-conjugating enzyme E2 variant 1 (UBE2V1), transcript variant 1 |
CNY 2,640.00 |
|
RC216178L3 | Lenti-ORF clone of UBE2V1 (Myc-DDK-tagged)-Human ubiquitin-conjugating enzyme E2 variant 1 (UBE2V1), transcript variant 1 |
CNY 5,890.00 |
|
RC216178L4 | Lenti-ORF clone of UBE2V1 (mGFP-tagged)-Human ubiquitin-conjugating enzyme E2 variant 1 (UBE2V1), transcript variant 1 |
CNY 5,890.00 |
|
RG216178 | UBE2V1 (tGFP-tagged) - Human ubiquitin-conjugating enzyme E2 variant 1 (UBE2V1), transcript variant 1 |
CNY 4,370.00 |