United States
Germany
Japan
United Kingdom
China
FNBP3 (PRPF40A) (NM_017892) Human Untagged Clone
CAT＃: SC312449
Homo sapiens PRP40 pre-mRNA processing factor 40 homolog A (S. cerevisiae) (PRPF40A) as transfection-ready DNA
CNY 19,190.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | FBP-11; FBP11; FLAF1; FNBP3; HIP-10; HIP10; HYPA; NY-REN-6; Prp40 |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_017892, the custom clone sequence may differ by one or more nucleotides
ATGTTAAAACAAGCTGCTCCTCCGATAGAATTGGATGCTGTCTGGGAAGATATCCGTGAG AGATTTGTAAAAGAGCCAGCATTTGAGGACATAACTCTAGAATCTGAAAGAAAACGAATA TTTAAAGATTTTATGCATGTGCTTGAGCATGAATGTCAGCATCATCATTCAAAGAACAAG AAACATTCTAAGAAATCTAAAAAACATCATAGGAAACGTTCCCGCTCTCGATCGGGGTCA GATTCAGATGATGATGATAGCCATTCAAAGAAAAAAAGACAGCGATCAGAGTCTCGTTCT GCTTCAGAACATTCTTCTAGTGCAGAGTCTGAGAGAAGTTATAAAAAGTCAAAAAAGCAT AAGAAGAAAAGTAAGAAGAGGAGACATAAATCTGACTCTCCAGAATCCGATGCTGAGCGA GAGAAGGATAAAAAAGAAAAAGATCGGGAAAGTGAAAAAGACAGAACTAGACAAAGATCA GAATCAAAACACAAATCGCCTAAGAAAAAGACTGGAAAGGATTCTGGTAATTGGGATACT TCTGGCAGCGAACTGAGTGAAGGGGAATTGGAAAAGCGCAGAAGAACCCTTTTGGAGCAA CTGGATGATGATCAA |
| Restriction Sites | Please inquire |
| ACCN | NM_017892 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_017892.2, NP_060362.2 |
| RefSeq Size | 1954 bp |
| RefSeq ORF | 618 bp |
| Locus ID | 55660 |
| UniProt ID | O75400 |
| Protein Pathways | Spliceosome |
| Gene Summary | Binds to WASL/N-WASP and suppresses its translocation from the nucleus to the cytoplasm, thereby inhibiting its cytoplasmic function (By similarity). Plays a role in the regulation of cell morphology and cytoskeletal organization. Required in the control of cell shape and migration. May play a role in cytokinesis. May be involved in pre-mRNA splicing.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) encodes the longest isoform (1). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. CCDS Note: This CCDS representation uses the 5'-most start codon that is available based on current long transcript support for this gene. However, it should be noted that an upstream in-frame start codon is present. The use of this start codon could potentially extend the protein N-terminus by 64 aa. Given the close proximity of this gene to the 5' end of the opposite strand ARL6IP6 gene, most EST evidence that includes this upstream start codon cannot be unambiguously assigned to the PRPF40A gene. In addition, the ESTs DC319474.1, CN365999.1 and DC360797.1 contain an intron that would splice out this start codon, and thus, at least some PRPF40A variants would use the downstream start codon, as represented here. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC211848 | PRPF40A (Myc-DDK-tagged)-Human PRP40 pre-mRNA processing factor 40 homolog A (S. cerevisiae) (PRPF40A) |
CNY 7,130.00 |
|
| RC211848L3 | Lenti-ORF clone of PRPF40A (Myc-DDK-tagged)-Human PRP40 pre-mRNA processing factor 40 homolog A (S. cerevisiae) (PRPF40A) |
CNY 9,030.00 |
|
| RC211848L4 | Lenti-ORF clone of PRPF40A (mGFP-tagged)-Human PRP40 pre-mRNA processing factor 40 homolog A (S. cerevisiae) (PRPF40A) |
CNY 9,030.00 |
|
| RG211848 | tGFP-tagged ORF clone of Homo sapiens PRP40 pre-mRNA processing factor 40 homolog A (S. cerevisiae) (PRPF40A) as transfection-ready DNA |
CNY 7,890.00 |
|
| SC318398 | Homo sapiens PRP40 pre-mRNA processing factor 40 homolog A (S. cerevisiae) (PRPF40A) as transfection-ready DNA |
CNY 19,190.00 |
其它PRPF40A产品
