PGPEP1 (NM_017712) Human Untagged Clone

CAT#: SC312465

PGPEP1 (untagged)-Human pyroglutamyl-peptidase I (PGPEP1)



  "NM_017712" in other vectors (6)

CNY 2,400.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-PGPEP1 Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms PAP-I; Pcp; PGI; PGP; PGP-I; PGPI
Vector pCMV6-XL6
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_017712 edited
ATGGAGCAGCCGAGGAAGGCGGTGGTAGTGACGGGATTTGGCCCTTTTGGGGAACACACC
GTGAACGCCAGTTGGATTGCAGTTCAGGAGCTAGAAAAGCTAGGCCTTGGCGACAGCGTG
GACCTGCATGTGTACGAGATTCCGGTTGAGTACCAAACAGTCCAGAGACTCATCCCCGCC
CTGTGGGAGAAGCACAGTCCACAGCTGGTGGTGCATGTGGGGGTGTCAGGCATGGCGACC
ACAGTCACACTGGAGAAATGTGGACACAACAAGGGCTACAAGGGGCTGGACAACTGCCGC
TTTTGCCCCGGCTCCCAGTGCTGCGTGGAGGACGGGCCTGAAAGCATTGACTCCATCATC
GACATGGATGCTGTGTGCAAGCGAGTCACCACGTTGGGCCTGGATGTGTCGGTGACCATC
TCGCAGGATGCCGGCAGATATCTCTGCGACTTTACCTACTACACCTCTTTGTACCAGAGT
CACGGTCGATCAGCCTTCGTCCACGTGCCCCCACTGGGGAAGCCGTACAACGCGGACCAG
CTGGGCAGGGCACTGAGAGCCATCATTGAGGAGATGTTGGACCTCCTGGAGCAGTCAGAG
GGCAAAATCAACTATTGCCACAAACAC
Restriction Sites Please inquire     
ACCN NM_017712
Insert Size 650 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_017712.1, NP_060182.1
RefSeq Size 2239 bp
RefSeq ORF 630 bp
Locus ID 54858
UniProt ID Q9NXJ5
Protein Families Druggable Genome, Protease
Gene Summary The gene encodes a cysteine protease and member of the peptidase C15 family of proteins. The encoded protein cleaves amino terminal pyroglutamate residues from protein substrates including thyrotropin-releasing hormone and other neuropeptides. Expression of this gene may be downregulated in colorectal cancer, while activity of the encoded protein may be negatively correlated with cancer progression in colorectal cancer patients. Activity of the encoded protease may also be altered in other disease states including in liver cirrhosis, which is associated with reduced protease activity, and in necrozoospermia, which is associated with elevated protease activity. [provided by RefSeq, Jul 2016]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...