United States
Germany
Japan
United Kingdom
China
Bcl 7A (BCL7A) (NM_020993) Human Untagged Clone
CAT＃: SC312558
BCL7A (untagged)-Human B-cell CLL/lymphoma 7A (BCL7A), transcript variant 1
CNY 2,400.00
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | BCL7 |
| Vector | pCMV6-XL4 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene ORF sequence for NM_020993 edited
ATGTCGGGCAGGTCGGTTCGAGCCGAGACGAGGAGCCGGGCCAAAGATGATATCAAGAGG GTCATGGCGGCGATCGAGAAAGTGCGCAAATGGGAGAAGAAATGGGTGACCGTTGGTGAC ACATCCCTACGAATCTACAAATGGGTCCCTGTGACGGAGCCCAAGGTTGATGACAAAAAC AAGAATAAGAAAAAAGGCAAGGACGAGAAGTGTGGCTCAGAGGTGACCACTCCGGAGAAC AGTTCCTCCCCAGGGATGATGGACATGCATGACGATAACAGCAACCAGAGCTCCATCGCA GATGCCTCCCCCATCAAACAGGAGAACAGCAGCAACTCCAGCCCCGCTCCAGAGCCCAAC TCGGCTGTGCCCAGCGACGGCACCGAGGCCAAGGTGGATGAGGCCCAGGCTGATGGGAAG GAGCACCCAGGAGCTGAAGATGCTTCTGATGAGCAGAATTCACAGTCCTCGATGGAACAT TCGATGAACAGCTCAGAGAAAGTAGATCGGCAGCCGTCTGGAGACTCGGGTCTGGCCGCA GAGACGTCTGCAATCTCTCAGGTACCTCGCTCGAGGTCTCAGAGGGGCAGCCAGATCGGC CGGGAGCCCATTGGGTTGTCGGGGGATTTGGAAGGAGTGCCACCCTCTAAAAAGATGAAA CTGGAGGCCTCTCAACAAAACTCCGAAGAGATGTAG |
| Restriction Sites | NotI-NotI |
| ACCN | NM_020993 |
| Insert Size | 2600 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The open reading frame of this clone has been fully sequenced and found one SNP within the protein associated with this reference, NM_020993.3. This SNP doesn't change amino acid. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_020993.3, NP_066273.1 |
| RefSeq Size | 3714 bp |
| RefSeq ORF | 696 bp |
| Locus ID | 605 |
| UniProt ID | Q4VC05 |
| Domains | BCL_N |
| Protein Families | Druggable Genome |
| Gene Summary | This gene is directly involved, with Myc and IgH, in a three-way gene translocation in a Burkitt lymphoma cell line. As a result of the gene translocation, the N-terminal region of the gene product is disrupted, which is thought to be related to the pathogenesis of a subset of high-grade B cell non-Hodgkin lymphoma. The N-terminal segment involved in the translocation includes the region that shares a strong sequence similarity with those of BCL7B and BCL7C. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC223737 | BCL7A (Myc-DDK-tagged)-Human B-cell CLL/lymphoma 7A (BCL7A), transcript variant 1 |
CNY 2,640.00 |
|
| RC223737L3 | Lenti-ORF clone of BCL7A (Myc-DDK-tagged)-Human B-cell CLL/lymphoma 7A (BCL7A), transcript variant 1 |
CNY 5,890.00 |
|
| RC223737L4 | Lenti-ORF clone of BCL7A (mGFP-tagged)-Human B-cell CLL/lymphoma 7A (BCL7A), transcript variant 1 |
CNY 5,890.00 |
|
| RG223737 | BCL7A (tGFP-tagged) - Human B-cell CLL/lymphoma 7A (BCL7A), transcript variant 1 |
CNY 4,370.00 |
