C19orf63 (EMC10) (NM_175063) Human Untagged Clone
CAT#: SC312710
EMC10 (untagged)-Human chromosome 19 open reading frame 63 (C19orf63), transcript variant HSS1
CNY 5,400.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | C19orf63; HSM1; HSS1 |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_175063 edited
ATGGCGGCAGCCAGCGCTGGGGCAACCCGGCTGCTCCTGCTCTTGCTGATGGCGGTAGCA GCGCCCAGTCGAGCCCGGGGCAGCGGCTGCCGGGCCGGGACTGGTGCGCGAGGGGCTGGG GCGGAAGGTCGAGAGGGCGAGGCCTGTGGCACGGTGGGGCTGCTGCTGGAGCACTCATTT GAGATCGATGACAGTGCCAACTTCCGGAAGCGGGGCTCACTGCTCTGGAACCAGCAGGAT GGTACCTTGTCCCTGTCACAGCGGCAGCTCAGCGAGGAGGAGCGGGGCCGACTCCGGGAT GTGGCAGCCCTGAATGGCCTGTACCGGGTCCGGATCCCAAGGCGACCCGGGGCCCTGGAT GGCCTGGAAGCTGGTGGCTATGTCTCCTCCTTTGTCCCTGCGTGCTCCCTGGTGGAGTCG CACCTGTCGGACCAGCTGACCCTGCACGTGGATGTGGCCGGCAACGTGGTGGGCGTGTCG GTGGTGACGCACCCTGGGGGCTGCCGGGGCCATGAGGTGGAGGACGTGGACCTGGAGCTG TTCAACACCTCGGTGCAGCTGCAGCCGCCCACCACAGCCCCAGGCCCTGAGACGGCGGCC TTCATTGAGCGCCTGGAGATGGAACAGGCCCAGAAGGCCAAGAACCCCCAGGAGCAGAAG TCCTTCTTCGCCAAATACTGGCACATCATCCTGGGGGGGGCCGTGTTGCTCACAGCCCTG CGTCCTGCTGCGCCAGGGCCCGCGCCACCGCCACAGGAGGCCTGA |
Restriction Sites | Please inquire |
ACCN | NM_175063 |
Insert Size | 1700 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to match NM_175063.4 perfectly. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_175063.3, NP_778233.3 |
RefSeq Size | 2740 bp |
RefSeq ORF | 2211 bp |
Locus ID | 284361 |
UniProt ID | Q5UCC4 |
Protein Families | Transmembrane |
Gene Summary | Promotes angiogenesis and tissue repair in the heart after myocardial infarction. Stimulates cardiac endothelial cell migration and outgrowth via the activation of p38 MAPK, PAK and MAPK2 signaling pathways.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longer transcript. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC215076 | EMC10 (Myc-DDK-tagged)-Human chromosome 19 open reading frame 63 (C19orf63), transcript variant HSS1 |
CNY 2,400.00 |
|
RC215076L3 | Lenti ORF clone of Human chromosome 19 open reading frame 63 (C19orf63), transcript variant HSS1, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC215076L4 | Lenti ORF clone of Human chromosome 19 open reading frame 63 (C19orf63), transcript variant HSS1, mGFP tagged |
CNY 5,890.00 |
|
RG215076 | EMC10 (tGFP-tagged) - Human chromosome 19 open reading frame 63 (C19orf63), transcript variant HSS1 |
CNY 4,370.00 |
其它C19orf63产品