RASSF1 (NM_170713) Human Untagged Clone
CAT#: SC312734
RASSF1 (untagged)-Human Ras association (RalGDS/AF-6) domain family member 1 (RASSF1), transcript variant C
CNY 6,270.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | 123F2; NORE2A; RASSF1A; RDA32; REH3P21 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC312734 representing NM_170713.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGGCGAGGCGGAGGCGCCTTCTTTCGAAATGACCTGGAGCAGCACGACGAGCAGTGGCTACTGCAGC CAAGAGGACTCGGACTCGGAGCTCGAGCAGTACTTCACCGCGCGAACCTCGCTAGCTCGCAGGCCGCGC CGGGACCAGGACGAGCCTGTGGAGTGGGAGACACCTGACCTTTCTCAAGCTGAGATTGAGCAGAAGATC AAGGAGTACAATGCCCAGATCAACAGCAACCTCTTCATGAGCTTGAACAAGGACGGTTCTTACACAGGC TTCATCAAGGTTCAGCTGAAGCTGGTGCGCCCTGTCTCTGTGCCCTCCAGCAAGAAGCCACCCTCCTTG CAGGATGCCCGGCGGGGCCCAGGACGGGGCACAAGTGTCAGGCGCCGCACTTCCTTTTACCTGCCCAAG GATGCTGTCAAGCACCTGCATGTGCTGTCACGCACAAGGGCACGTGAAGTCATTGAGGCCCTGCTGCGA AAGTTCTTGGTGGTGGATGACCCCCGCAAGTTTGCACTCTTTGAGCGCGCTGAGCGTCACGGCCAAGTG TACTTGCGGAAGCTGTTGGATGATGAGCAGCCCCTGCGGCTGCGGCTCCTGGCAGGGCCCAGTGACAAG GCCCTGAGCTTTGTCCTGAAGGAAAATGACTCTGGGGAGGTGAACTGGGACGCCTTCAGCATGCCTGAA CTACATAACTTCCTACGTATCCTGCAGCGGGAGGAGGAGGAGCACCTCCGCCAGATCCTGCAGAAGTAC TCCTATTGCCGCCAGAAGATCCAAGAGGCCCTGCACGCCTGCCCCCTTGGGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_170713 |
Insert Size | 813 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_170713.2 |
RefSeq Size | 1770 bp |
RefSeq ORF | 813 bp |
Locus ID | 11186 |
UniProt ID | Q9NS23 |
Domains | RA |
Protein Families | Druggable Genome |
Protein Pathways | Bladder cancer, Non-small cell lung cancer, Pathways in cancer |
MW | 31.2 kDa |
Gene Summary | This gene encodes a protein similar to the RAS effector proteins. Loss or altered expression of this gene has been associated with the pathogenesis of a variety of cancers, which suggests the tumor suppressor function of this gene. The inactivation of this gene was found to be correlated with the hypermethylation of its CpG-island promoter region. The encoded protein was found to interact with DNA repair protein XPA. The protein was also shown to inhibit the accumulation of cyclin D1, and thus induce cell cycle arrest. Several alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, May 2011] Transcript Variant: This variant (C) differs in the 5' end region compared to variant D. The resulting isoform (C) has a distinct and shorter N-terminus, as compared to isoform D. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC212843 | RASSF1 (Myc-DDK-tagged)-Human Ras association (RalGDS/AF-6) domain family member 1 (RASSF1), transcript variant C |
CNY 2,400.00 |
|
RC212843L1 | Lenti ORF clone of Human Ras association (RalGDS/AF-6) domain family member 1 (RASSF1), transcript variant C, Myc-DDK-tagged |
CNY 4,800.00 |
|
RC212843L2 | Lenti ORF clone of Human Ras association (RalGDS/AF-6) domain family member 1 (RASSF1), transcript variant C, mGFP tagged |
CNY 4,800.00 |
|
RC212843L3 | Lenti ORF clone of Human Ras association (RalGDS/AF-6) domain family member 1 (RASSF1), transcript variant C, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC212843L4 | Lenti ORF clone of Human Ras association (RalGDS/AF-6) domain family member 1 (RASSF1), transcript variant C, mGFP tagged |
CNY 5,890.00 |
|
RG212843 | RASSF1 (tGFP-tagged) - Human Ras association (RalGDS/AF-6) domain family member 1 (RASSF1), transcript variant C |
CNY 4,370.00 |