galectin 9 (LGALS9) (NM_009587) Human Untagged Clone
CAT#: SC313107
LGALS9 (untagged)-Human lectin, galactoside-binding, soluble, 9 (LGALS9), transcript variant 1
CNY 3,656.00
CNY 5,700.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | HUAT; LGALS9A |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_009587 edited
ATGGCCTTCAGCGGTTCCCAGGCTCCCTACCTGAGTCCAGCTGTCCCCTTTTCTGGGACT ATTCAAGGAGGTCTCCAGGACGGACTTCAGATCACTGTCAATGGGACCGTTCTCAGCTCC AGTGGAACCAGGTTTGCTGTGAACTTTCAGACTGGCTTCAGTGGAAATGACATTGCCTTC CACTTCAACCCTCGGTTTGAAGATGGAGGGTACGTGGTGTGCAACACGAGGCAGAACGGA AGCTGGGGGCCCGAGGAGAGGAAGACACACATGCCTTTCCAGAAGGGGATGCCCTTTGAC CTCTGCTTCCTGGTGCAGAGCTCAGATTTCAAGGTGATGGTGAACGGGATCCTCTTCGTG CAGTACTTCCACCGCGTGCCCTTCCACCGTGTGGACACCATCTCCGTCAATGGCTCTGTG CAGCTGTCCTACATCAGCTTCCAGAACCCCCGCACAGTCCCTGTTCAGCCTGCCTTCTCC ACGGTGCCGTTCTCCCAGCCTGTCTGTTTCCCACCCAGGCCCAGGGGGCGCAGACAAAAA CCTCCCGGCGTGTGGCCTGCCAACCCGGCTCCCATTACCCAGACAGTCATCCACACAGTG CAGAGCGCCCCTGGACAGATGTTCTCTACTCCCGCCATCCCACCTATGATGTACCCCCAC CCCGCCTATCCGATGCCTTTCATCACCACCATTCTGGGAGGGCTGTACCCATCCAAGTCC ATCCTCCTGTCAGGCACTGTCCTGCCCAGTGCTCAGAGGTTCCACATCAACCTGTGCTCT GGGAACCACATCGCCTTCCACCTGAACCCCCGTTTTGATGAGAATGCTGTGGTCCGCAAC ACCCAGATCGACAACTCCTGGGGGTCTGAGGAGCGAAGTCTGCCCCGAAAAATGCCCTTC GTCCGTGGCCAGAGCTTCTCAGTGTGGATCTTGTGTGAAGCTCACTGCCTCAAGGTGGCC GTGGATGGTCAGCACCTGTTTGAATACTACCATCGCCTGAGGAACCTGCCCACCATCAAC AGACTGGAAGTGGGGGGCGACATCCAGCTGACCCATGTGCAGACATAG |
Restriction Sites | Please inquire |
ACCN | NM_009587 |
Insert Size | 1100 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_009587.2. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_009587.1, NP_033665.1 |
RefSeq Size | 1696 bp |
RefSeq ORF | 1068 bp |
Locus ID | 3965 |
UniProt ID | O00182 |
Domains | Gal-bind_lectin |
Gene Summary | The galectins are a family of beta-galactoside-binding proteins implicated in modulating cell-cell and cell-matrix interactions. The protein encoded by this gene is an S-type lectin. It is overexpressed in Hodgkin's disease tissue and might participate in the interaction between the H&RS cells with their surrounding cells and might thus play a role in the pathogenesis of this disease and/or its associated immunodeficiency. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) encodes the longer isoform (long). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC219435 | LGALS9 (Myc-DDK-tagged)-Human lectin, galactoside-binding, soluble, 9 (LGALS9), transcript variant 1 |
CNY 3,656.00 |
|
RC219435L1 | Lenti ORF clone of Human lectin, galactoside-binding, soluble, 9 (LGALS9), transcript variant 1, Myc-DDK-tagged |
CNY 6,056.00 |
|
RC219435L2 | Lenti ORF clone of Human lectin, galactoside-binding, soluble, 9 (LGALS9), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RC219435L3 | Lenti ORF clone of Human lectin, galactoside-binding, soluble, 9 (LGALS9), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC219435L4 | Lenti ORF clone of Human lectin, galactoside-binding, soluble, 9 (LGALS9), transcript variant 1, mGFP tagged |
CNY 6,056.00 |
|
RG219435 | LGALS9 (tGFP-tagged) - Human lectin, galactoside-binding, soluble, 9 (LGALS9), transcript variant 1 |
CNY 5,256.00 |
其它galectin 9产品