PTPLAD1 (HACD3) (NM_016395) Human Untagged Clone

CAT#: SC313184

PTPLAD1 (untagged)-Human protein tyrosine phosphatase-like A domain containing 1 (PTPLAD1)



  "NM_016395" in other vectors (4)

CNY 4,024.00

CNY 7,220.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-PTPLAD1 Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms B-IND1; BIND1; HSPC121; PTPLAD1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC313184 representing NM_016395.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAGAATCAGGTGTTGACGCCGCATGTCTACTGGGCTCAGCGACACCGCGAGCTATATCTGCGCGTG
GAGCTGAGTGACGTACAGAACCCTGCCATCAGCATCACTGAAAACGTGCTGCATTTCAAAGCTCAAGGA
CATGGTGCCAAAGGAGACAATGTCTATGAATTTCACCTGGAGTTCTTAGACCTTGTGAAACCAGAGCCT
GTTTACAAACTGACCCAGAGGCAGGTAAACATTACAGTACAGAAGAAAGTGAGTCAGTGGTGGGAGAGA
CTCACAAAGCAGGAAAAGCGACCACTGTTTTTGGCTCCTGACTTTGATCGTTGGCTGGATGAATCTGAT
GCGGAAATGGAGCTCAGAGCTAAGGAAGAAGAGCGCCTAAATAAACTCCGACTGGAAAGCGAAGGCTCT
CCTGAAACTCTTACAAACTTAAGGAAAGGATACCTGTTTATGTATAATCTTGTGCAATTCTTGGGATTC
TCCTGGATCTTTGTCAACCTGACTGTGCGATTCTGTATCTTGGGAAAAGAGTCCTTTTATGACACATTC
CATACTGTGGCTGACATGATGTATTTCTGCCAGATGCTGGCAGTTGTGGAAACTATCAATGCAGCAATT
GGAGTCACTACGTCACCGGTGCTGCCTTCTCTGATCCAGCTTCTTGGAAGAAATTTTATTTTGTTTATC
ATCTTTGGCACCATGGAAGAAATGCAGAACAAAGCTGTGGTTTTCTTTGTGTTTTATTTGTGGAGTGCA
ATTGAAATTTTCAGGTACTCTTTCTACATGCTGACGTGCATTGACATGGATTGGAAGGTGCTCACATGG
CTTCGTTACACTCTGTGGATTCCCTTATATCCACTGGGATGTTTGGCGGAAGCTGTCTCAGTGATTCAG
TCCATTCCAATATTCAATGAGACCGGACGATTCAGTTTCACATTGCCATATCCAGTGAAAATCAAAGTT
AGATTTTCCTTTTTTCTTCAGATTTATCTTATAATGATATTTTTAGGTTTATACATAAATTTTCGTCAC
CTTTATAAACAGCGCAGACGGCGCTATGGACAAAAAAAGAAAAAGATCCACTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_016395
Insert Size 1089 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_016395.2
RefSeq Size 3213 bp
RefSeq ORF 1089 bp
Locus ID 51495
UniProt ID Q9P035
Domains PTPLA
Protein Families Transmembrane
MW 43.2 kDa
Gene Summary Catalyzes the third of the four reactions of the long-chain fatty acids elongation cycle. This endoplasmic reticulum-bound enzymatic process, allows the addition of two carbons to the chain of long- and very long-chain fatty acids/VLCFAs per cycle. This enzyme catalyzes the dehydration of the 3-hydroxyacyl-CoA intermediate into trans-2,3-enoyl-CoA, within each cycle of fatty acid elongation. Thereby, it participates in the production of VLCFAs of different chain lengths that are involved in multiple biological processes as precursors of membrane lipids and lipid mediators. May be involved in Rac1-signaling pathways leading to the modulation of gene expression. Promotes insulin receptor/INSR autophosphorylation and is involved in INSR internalization (PubMed:25687571).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...