SERPINB8 (NM_002640) Human Untagged Clone
CAT#: SC313190
SERPINB8 (untagged)-Human serpin peptidase inhibitor, clade B (ovalbumin), member 8 (SERPINB8), transcript variant 1
CNY 3,656.00
CNY 6,080.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | C18orf53; CAP2; PI-8; PI8; PSS5 |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_002640 edited
ATGGATGACCTCTGTGAAGCAAATGGCACTTTTGCCATCAGCTTATTTAAAATATTGGGG GAAGAGGACAACTCAAGAAACGTATTCTTCTCTCCCATGAGCATCTCCTCTGCCCTGGCC ATGGTCTTCATGGGGGCAAAGGGAAGCACTGCAGCCCAGATGTCCCAGGCACTTTGTTTA TACAAAGACGGAGATATTCACCGAGGTTTCCAGTCACTTCTCAGTGAAGTTAACAGAACT GGCACTCAGTACTTGCTTAGAACTGCCAACAGACTCTTTGGAGAAAAGACGTGTGATTTC CTTCCAGACTTTAAAGAATACTGTCAGAAGTTCTATCAGGCAGAGCTGGAGGAGTTGTCC TTTGCTGAAGACACTGAAGAGTGCAGGAAGCATATAAATGACTGGGTGGCAGAGAAGACT GAAGGTAAGATTTCAGAGGTACTGGATGCTGGGACAGTCGATCCCCTGACAAAGCTAGTC CTTGTGAATGCCATTTATTTCAAGGGAAAGTGGAATGAGCAATTTGACAGAAAGTACACA AGGGGAATGCTCTTTAAAACCAACGAGGAAAAAAAGACAGTGCAGATGATGTTTAAGGAA GCTAAGTTTAAAATGGGGTATGCGGATGAGGTACACACCCAGGTCCTGGAGCTGCCCTAT GTGGAAGAGGAGCTGAGCATGGTCATTCTGCTTCCCGATGACAACACGGACCTCGCCGTG GTGGAAAAAGCACTTACATATGAGAAATTCAAAGCCTGGACAAATTCAGAAAAGTTGACA AAAAGTAAGGTTCAAGTTTTCCTTCCCAGATTAAAGCTGGAGGAGAGTTATGACTTGGAG CCTTTCCTTCGAAGATTAGGAATGATCGATGCTTTTGACGAAGCCAAGGCAGACTTTTCT GGAATGTCAACTGAGAAGAATGTGCCTCTGTCCAAGGTTGCTCACAAGTGCTTCGTGGAG GTCAATGAGGAAGGCACAGAGGCTGCCGCAGCCACTGCTGTGGTCAGGAATTCCCGGTGC AGCAGAATGGAGCCAAGATTCTGTGCAGACCACCCTTTTCTTTTCTTCATCAGGCGCCAC AAAACCAACTGCATCTTGTTCTGTGGCAGGTTCTCTTCTCCGTAA |
Restriction Sites | Please inquire |
ACCN | NM_002640 |
Insert Size | 3600 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_002640.3, NP_002631.3 |
RefSeq Size | 3390 bp |
RefSeq ORF | 1125 bp |
Locus ID | 5271 |
UniProt ID | P50452 |
Domains | SERPIN |
Protein Families | Druggable Genome |
Gene Summary | The protein encoded by this gene is a member of the ov-serpin family of serine protease inhibitors. The encoded protein is produced by platelets and can bind to and inhibit the function of furin, a serine protease involved in platelet functions. In addition, this protein has been found to enhance the mechanical stability of cell-cell adhesion in the skin, and defects in this gene have been associated with an autosomal-recessive form of exfoliative ichthyosis. [provided by RefSeq, Jan 2017] Transcript Variant: This variant (1) uses an alternate splice junction in the 5' UTR compared to variant 2. Variants 1, 2 and 10 encode the same isoform (a). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC223880 | SERPINB8 (Myc-DDK-tagged)-Human serpin peptidase inhibitor, clade B (ovalbumin), member 8 (SERPINB8), transcript variant 1 |
CNY 3,656.00 |
|
RC223880L3 | Lenti ORF clone of Human serpin peptidase inhibitor, clade B (ovalbumin), member 8 (SERPINB8), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC223880L4 | Lenti ORF clone of Human serpin peptidase inhibitor, clade B (ovalbumin), member 8 (SERPINB8), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RG223880 | SERPINB8 (tGFP-tagged) - Human serpin peptidase inhibitor, clade B (ovalbumin), member 8 (SERPINB8), transcript variant 1 |
CNY 4,370.00 |
其它SERPINB8产品