KRT13 (NM_002274) Human Untagged Clone

CAT#: SC313385

KRT13 (untagged)-Human keratin 13 (KRT13), transcript variant 2



  "NM_002274" in other vectors (4)

CNY 6,750.00


货期*
6周

规格
    • 10 ug

Product images

经常一起买 (4)
Anti-KRT13 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CK13; K13; WSN2
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_002274, the custom clone sequence may differ by one or more nucleotides
ATGAGCCTCCGCCTGCAGAGCTCCTCTGCCAGCTATGGAGGTGGTTTCGGGGGTGGCTCT
TGCCAGCTGGGAGGAGGCCGTGGTGTCTCTACCTGTTCAACTCGGTTTGTGTCTGGGGGA
TCAGCTGGGGGCTATGGAGGCGGCGTGAGCTGTGGTTTTGGTGGAGGGGCTGGTAGTGGC
TTTGGAGGTGGCTATGGAGGTGGCCTTGGAGGTGGCTATGGAGGTGGCCTTGGAGGTGGC
TTTGGTGGGGGTTTTGCTGGTGGCTTTGTTGACTTTGGTGCTTGTGATGGCGGCCTCCTC
ACTGGCAATGAGAAGATCACCATGCAGAACCTCAACGACCGCCTGGCTTCCTACCTGGAG
AAGGTGCGCGCCCTGGAGGAGGCCAACGCTGACCTGGAGGTGAAGATCCGTGACTGGCAC
CTGAAGCAGAGCCCAGCTAGCCCTGAGCGGGACTACAGCCCCTACTACAAGACCATTGAA
GAGCTCCGGGACAAGATCCTGACCGCCACCATTGAAAACAACCGGGTCATCCTGGAGATT
GACAATGCCAGGCTGGCTGTGGACGACTTCAGGCTCAAGTATGAGAATGAGCTGGCCCTG
CGCCAGAGCGTGGAGGCCGACATCAACGGCCTGCGCCGGGTGCTGGATGAGCTCACTCTG
TCTAAGACTGACCTGGAGATGCAGATCGAGAGCCTGAATGAAGAGCTAGCCTACATGAAG
AAGAACCATGAAGAGGAGATGAAGGAATTTAGCAACCAGGTGGTCGGCCAGGTCAACGTG
GAGATGGATGCCACCCCAGGCATTGACCTGACCCGCGTGCTGGCAGAGATGAGGGAGCAG
TACGAGGCCATGGCAGAGAGGAACCGCCGGGATGCTGAGGAATGGTTCCACGCCAAGAGT
GCAGAGCTGAACAAGGAGGTGTCTACCAACACTGCCATGATTCAGACCAGCAAGACAGAG
ATCACGGAGCTCAGGCGCACGCTCCAAGGCCTGGAGATTGAGCTGCAGTCCCAGCTGAGC
ATGAAAGCGGGGCTGGAGAACACGGTGGCAGAGACGGAGTGCCGCTATGCCCTGCAGCTG
CAGCAGATCCAGGGACTCATCAGCAGCATCGAGGCCCAGCTGAGCGAGCTCCGCAGTGAG
ATGGAGTGCCAGAACCAAGAGTACAAGATGCTGCTGGACATCAAGACACGTCTGGAGCAG
GAGATCGCCACCTACCGCAGCCTGCTCGAGGGCCAGGACGCCAAGAAGCGTCAGCCCCCG
Restriction Sites Please inquire     
ACCN NM_002274
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_002274.2, NP_002265.1
RefSeq Size 1693 bp
RefSeq ORF 1263 bp
Locus ID 3860
UniProt ID P13646
Domains filament
Gene Summary The protein encoded by this gene is a member of the keratin gene family. The keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into cytokeratins and hair keratins. Most of the type I cytokeratins consist of acidic proteins which are arranged in pairs of heterotypic keratin chains. This type I cytokeratin is paired with keratin 4 and expressed in the suprabasal layers of non-cornified stratified epithelia. Mutations in this gene and keratin 4 have been associated with the autosomal dominant disorder White Sponge Nevus. The type I cytokeratins are clustered in a region of chromosome 17q21.2. Alternative splicing of this gene results in multiple transcript variants; however, not all variants have been described. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) utilizes an alternate splice site in the 3' coding region, which results in a frameshift and early stop codon, compared to transcript variant 1. The encoded isoform (b) is shorter, compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...