UBL5 (NM_001048241) Human Untagged Clone

CAT#: SC315393

UBL5 (untagged)-Human ubiquitin-like 5 (UBL5), transcript variant 2



  "NM_001048241" in other vectors (6)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
UBL5 Rabbit pAb
    • 100 ul

CNY 2,640.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HUB1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC315393 representing NM_001048241.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGATCGAGGTTGTTTGCAACGACCGTCTGGGGAAGAAGGTCCGCGTTAAATGCAACACGGATGATACC
ATCGGGGACCTTAAGAAGCTGATTGCAGCCCAAACTGGTACCCGTTGGAACAAGATTGTCCTGAAGAAG
TGGTACACGATTTTTAAGGACCACGTGTCTCTGGGGGACTATGAAATCCACGATGGGATGAACCTGGAG
CTTTATTATCAATAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001048241
Insert Size 222 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001048241.2
RefSeq Size 469 bp
RefSeq ORF 222 bp
Locus ID 59286
UniProt ID Q9BZL1
MW 8.5 kDa
Gene Summary This gene encodes a member of a group of proteins similar to ubiquitin. The encoded protein is not thought to degrade proteins like ubiquitin but to affect their function through being bound to target proteins by an isopeptide bond. The gene product has been studied as a link to predisposition to obesity based on its expression in Psammomys obesus, the fat sand rat, which is an animal model for obesity studies. Variation in this gene was found to be significantly associated with some metabolic traits (PMID: 15331561) but not associated with childhood obesity (PMID: 19189687). Pseudogenes of this gene are located on chromosomes 3, 5 and 17. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jan 2013]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...