TNFAIP8 (NM_001077654) Human Untagged Clone
CAT#: SC315484
TNFAIP8 (untagged)-Human tumor necrosis factor, alpha-induced protein 8 (TNFAIP8), transcript variant 2
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | GG2-1; MDC-3.13; NDED; SCC-S2; SCCS2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC315484 representing NM_001077654.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCCACAGATGTCTTTAATTCCAAAAACCTGGCCGTTCAGGCACAAAAGAAGATCTTGGGTAAAATG GTGTCCAAATCCATCGCCACCACCTTAATAGACGACACAAGTAGTGAGGTGCTGGATGAGCTCTACAGA GTGACCAGGGAGTACACCCAAAACAAGAAGGAGGCAGAGAAGATCATCAAGAACCTCATCAAGACAGTC ATCAAGCTGGCCATTCTTTATAGGAATAATCAGTTTAATCAAGATGAGCTAGCATTGATGGAGAAATTT AAGAAGAAAGTTCATCAGCTTGCTATGACCGTGGTCAGTTTCCATCAGGTGGATTATACCTTTGACCGG AATGTGTTATCCAGGCTGTTAAATGAATGCAGAGAGATGCTGCACCAAATCATTCAGCGCCACCTCACT GCCAAGTCACATGGACGGGTTAATAATGTGTTTGATCATTTTTCAGATTGTGAATTTTTGGCTGCCTTG TATAATCCTTTTGGGAATTTTAAACCCCACTTACAAAAACTATGTGATGGTATCAACAAAATGTTGGAT GAAGAGAACATATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001077654 |
Insert Size | 567 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001077654.2 |
RefSeq Size | 2017 bp |
RefSeq ORF | 567 bp |
Locus ID | 25816 |
UniProt ID | O95379 |
Protein Families | Druggable Genome |
MW | 21.9 kDa |
Gene Summary | Acts as a negative mediator of apoptosis and may play a role in tumor progression. Suppresses the TNF-mediated apoptosis by inhibiting caspase-8 activity but not the processing of procaspase-8, subsequently resulting in inhibition of BID cleavage and caspase-3 activation.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) contains an alternate 5'-terminal exon and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (b) has a shorter and distinct N-terminus, compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC220669 | TNFAIP8 (Myc-DDK-tagged)-Human tumor necrosis factor, alpha-induced protein 8 (TNFAIP8), transcript variant 2 |
CNY 2,400.00 |
|
RC220669L1 | Lenti ORF clone of Human tumor necrosis factor, alpha-induced protein 8 (TNFAIP8), transcript variant 2, Myc-DDK-tagged |
CNY 4,800.00 |
|
RC220669L2 | Lenti ORF clone of Human tumor necrosis factor, alpha-induced protein 8 (TNFAIP8), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RC220669L3 | Lenti ORF clone of Human tumor necrosis factor, alpha-induced protein 8 (TNFAIP8), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC220669L4 | Lenti ORF clone of Human tumor necrosis factor, alpha-induced protein 8 (TNFAIP8), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG220669 | TNFAIP8 (tGFP-tagged) - Human tumor necrosis factor, alpha-induced protein 8 (TNFAIP8), transcript variant 2 |
CNY 4,000.00 |
其它TNFAIP8产品