MCL1 (NM_021960) Human Untagged Clone
CAT#: SC315538
MCL1 (untagged)-Human myeloid cell leukemia sequence 1 (BCL2-related) (MCL1), nuclear gene encoding mitochondrial protein, transcript variant 1
CNY 5,488.00
Cited in 9 publications. |
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | bcl2-L-3; BCL2L3; EAT; Mcl-1; MCL1-ES; mcl1/EAT; MCL1L; MCL1S; TM |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_021960 edited
ATGTTTGGCCTCAAAAGAAACGCGGTAATCGGACTCAACCTCTACTGTGGGGGGGCCGGC TTGGGGGCCGGCAGCGGCGGCGCCACCCGCCCGGGAGGGCGACTTTTGGCTACGGAGAAG GAGGCCTCGGCCCGGCGAGAGATAGGGGGAGGGGAGGCCGGCGCGGTGATTGGCGGAAGC GCCGGCGCAAGCCCCCCGTCCACCCTCACGCCAGACTCCCGGAGGGTCGCGCGGCCGCCG CCCATTGGCGCCGAGGTCCCCGACGTCACCGCGACCCCCGCGAGGCTGCTTTTCTTCGCG CCCACCCGCCGCGCGGCGCCGCTTGAGGAGATGGAAGCCCCGGCCGCTGACGCCATCATG TCGCCCGAAGAGGAGCTGGACGGGTACGAGCCGGAGCCTCTCGGGAAGCGGCCGGCTGTC CTGCCGCTGCTGGAGTTGGTCGGGGAATCTGGTAATAACACCAGTACGGACGGGTCACTA CCCTCGACGCCGCCGCCAGCAGAGGAGGAGGAGGACGAGTTGTACCGGCAGTCGCTGGAG ATTATCTCTCGGTACCTTCGGGAGCAGGCCACCGGCGCCAAGGACACAAAGCCAATGGGC AGGTCTGGGGCCACCAGCAGGAAGGCGCTGGAGACCTTACGACGGGTTGGGGATGGCGTG CAGCGCAACCACGAGACGGCCTTCCAAGGCATGCTTCGGAAACTGGACATCAAAAACGAA GACGATGTGAAATCGTTGTCTCGAGTGATGATCCATGTTTTCAGCGACGGCGTAACAAAC TGGGGCAGGATTGTGACTCTCATTTCTTTTGGTGCCTTTGTGGCTAAACACTTGAAGACC ATAAACCAAGAAAGCTGCATCGAACCATTAGCAGAAAGTATCACAGACGTTCTCGTAAGG ACAAAACGGGACTGGCTAGTTAAACAAAGAGGCTGGGATGGGTTTGTGGAGTTCTTCCAT GTAGAGGACCTAGAAGGTGGCATCAGGAATGTGCTGCTGGCTTTTGCAGGTGTTGCTGGA GTAGGAGCTGGTTTGGCATATCTAATAAGATAG |
Restriction Sites | NotI-NotI |
ACCN | NM_021960 |
Insert Size | 2400 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_021960.3. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_021960.3, NP_068779.1 |
RefSeq Size | 4020 bp |
RefSeq ORF | 1053 bp |
Locus ID | 4170 |
UniProt ID | Q07820 |
Domains | Bcl-2 |
Protein Families | Druggable Genome, Transmembrane |
Gene Summary | This gene encodes an anti-apoptotic protein, which is a member of the Bcl-2 family. Alternative splicing results in multiple transcript variants. The longest gene product (isoform 1) enhances cell survival by inhibiting apoptosis while the alternatively spliced shorter gene products (isoform 2 and isoform 3) promote apoptosis and are death-inducing. [provided by RefSeq, Oct 2010] Transcript Variant: This variant (1), also known as MCL-1L (long), represents the longest transcript and encodes the longest isoform (1). |
Citations (9)
The use of this cDNA Clones has been cited in the following citations: |
---|
Sensitizing non-small cell lung cancer to BCL-xL-targeted apoptosis
,Shen, Q;Li, J;Mai, J;Zhang, Z;Fisher, A;Wu, X;Li, Z;Ramirez, MR;Chen, S;Shen, H;,
Cell Death Dis
,PubMed ID 30250075
[MCL1]
|
Proteasome inhibition enhances the efficacy of volasertib-induced mitotic arrest in AML in vitro and prolongs survival in vivo
,Schnerch, D;Schüler, J;Follo, M;Felthaus, J;Wider, D;Klingner, K;Greil, C;Duyster, J;Engelhardt, M;Wäsch, R;,
Oncotarget
,PubMed ID 28416751
[MCL1]
|
FBXW7 Mediates Chemotherapeutic Sensitivity and Prognosis in NSCLC
,Yokobori, T;Yokoyama, Y;Mogi, A;Endoh, H;Altan, B;Kosaka, T;Yamaki, E;Yajima, T;Tomizawa, K;Azuma, Y;Onozato, R;Miyazaki, T;Tanaka, S;Kuwano, H;,
Mol Cancer Res. 2013 Oct 28
,PubMed ID 24165483
[MCL1]
|
Targeting acute myeloid leukemia by dual inhibition of PI3K signaling and Cdk9-mediated Mcl-1 transcription
,Daniel Thomas, Jason A. Powell, Francois Vergez, David H. Segal, Nhu-Y. N. Nguyen, Adele Baker, Tse-Chieh Teh, Emma F. Barry, Jean-Emmanuel Sarry, Erwin M. Lee, Tracy L. Nero, Anissa M. Jabbour, Giovanna Pomilio, Benjamin D. Green, Stéphane Manenti, Stefan P. Glaser, Michael W. Parker, Angel F. Lopez, Paul G. Ekert, Richard B. Lock, David C. S. Huang, Susie K. Nilsson, Christian Récher, Andrew H. Wei, and Mark A. Guthridge,
Blood, Aug 2013; 122: 738 - 748.
,PubMed ID 23775716
[MCL1]
|
Overexpression of Mcl-1 Confers Multidrug Resistance, Whereas Topoisomerase IIß Downregulation Introduces Mitoxantrone-Specific Drug Resistance in Acute Myeloid Leukemia
,David L. Hermanson, Sonia G. Das, Yunfang Li, and Chengguo Xing,
Mol. Pharmacol., Aug 2013; 84: 236 - 243.
,PubMed ID 23696245
[MCL1]
|
Sorafenib decreases proliferation and induces apoptosis of prostate cancer cells by inhibition of the androgen receptor and Akt signaling pathways
,Su Jung Oh, Holger H H Erb, Alfred Hobisch, Frédéric R Santer, and Zoran Culig,
Endocr. Relat. Cancer, Jun 2012; 19: 305 - 319.
[MCL1]
|
N-a-Acetyltransferase 10 protein inhibits apoptosis through RelA/p65-regulated MCL1 expression
,Huiyu Xu, Beihai Jiang, Lin Meng, Tingting Ren, Yan Zeng, Jian Wu, Like Qu, and Chengchao Shou,
Carcinogenesis, Apr 2012; 10.1093/carcin/bgs144.
[MCL1]
|
miR-193b Regulates Mcl-1 in Melanoma
,null,
The American Journal of Pathology
,PubMed ID 21893020
[MCL1]
|
Mitogen-Activated Protein Kinase Inhibition Induces Translocation of Bmf to Promote Apoptosis in Melanoma
,Matthew W. VanBrocklin, Monique Verhaegen, Maria S. Soengas, and Sheri L. Holmen,
Cancer Res., Mar 2009; 69: 1985 - 1994.
[MCL1]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC200521 | MCL1 (Myc-DDK-tagged)-Human myeloid cell leukemia sequence 1 (BCL2-related) (MCL1), nuclear gene encoding mitochondrial protein, transcript variant 1 |
CNY 5,320.00 |
|
RC200521L1 | Lenti ORF clone of Human myeloid cell leukemia sequence 1 (BCL2-related) (MCL1), nuclear gene encoding mitochondrial protein, transcript variant 1, Myc-DDK-tagged |
CNY 7,888.00 |
|
RC200521L2 | Lenti ORF clone of Human myeloid cell leukemia sequence 1 (BCL2-related) (MCL1), nuclear gene encoding mitochondrial protein, transcript variant 1, mGFP tagged |
CNY 7,888.00 |
|
RC200521L3 | Lenti ORF clone of Human myeloid cell leukemia sequence 1 (BCL2-related) (MCL1), nuclear gene encoding mitochondrial protein, transcript variant 1, Myc-DDK-tagged |
CNY 7,888.00 |
|
RC200521L4 | Lenti ORF clone of Human myeloid cell leukemia sequence 1 (BCL2-related) (MCL1), nuclear gene encoding mitochondrial protein, transcript variant 1, mGFP tagged |
CNY 7,888.00 |
|
RG200521 | MCL1 (tGFP-tagged) - Human myeloid cell leukemia sequence 1 (BCL2-related) (MCL1), nuclear gene encoding mitochondrial protein, transcript variant 1 |
CNY 7,088.00 |