Glutathione S Transferase theta 2 (GSTT2B) (NM_001080843) Human Untagged Clone

CAT#: SC315934

GSTT2B (untagged)-Human glutathione S-transferase theta 2B (gene/pseudogene) (GSTT2B)



  "NM_001080843" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
GSTT2B Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms GSTT2P
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC315934 representing NM_001080843.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGCCTAGAGCTGTTTCTTGACCTGGTGTCCCAGCCCAGCCGCGCCGTCTACATCTTCGCCAAGAAG
AATGGCATCCCCTTAGAGCTGCGCACCGTGGATTTGGTCAAAGGGCAGCACAAGAGCAAGGAGTTCTTG
CAGATCAACAGCCTGGGGAAACTGCCGACGCTCAAGGATGGTGATTTCATCTTGACCGAAAGCTCGGCC
ATCCTGATTTACCTGAGCTGTAAGTACCAGACGCCGGACCACTGGTATCCATCTGACCTGCAGGCTCGT
GCCCGTGTTCATGAGTACCTGGGCTGGCATGCCGACTGCATCCGTGGCACCTTTGGTATACCCCTGTGG
GTCCAGGTGTTGGGGCCACTCATTGGGGTCCAGGTGCCCGAGGAGAAGGTGGAACGCAACAGGACTGCC
ATGGACCAGGCCCTGCAATGGCTGGAGGACAAGTTCCTGGGGGACAGGCCCTTCCTCGCTGGCCAGCAG
GTGACACTGGCTGATCTCATGGCCCTGGAGGAGCTGATGCAGCCGGTGGCTCTCGGCTATGAACTGTTT
GAGGGACGGCCACGACTGGCAGCATGGCGTGGACGAGTGGAGGCTTTCCTGGGTGCTGAGCTATGCCAG
GAGGCCCACAGCATCATCTTGAGCATCCTGGAACAGGCGGCCAAGAAAACCCTCCCAACACCCTCACCA
GAGGCCTATCAGGCTATGCTGCTTCGAATCGCCAGGATCCCCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001080843
Insert Size 735 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001080843.3
RefSeq Size 1108 bp
RefSeq ORF 735 bp
Locus ID 653689
UniProt ID P0CG30
MW 27.5 kDa
Gene Summary The protein encoded by this gene, glutathione S-transferase (GST) theta 2B (GSTT2B), is a member of a superfamily of proteins that catalyze the conjugation of reduced glutathione to a variety of electrophilic and hydrophobic compounds. Human GSTs can be divided into five main classes: alpha, mu, pi, theta, and zeta. The theta class includes GSTT1, GSTT2, and GSTT2B. GSTT2 and GSTT2B are nearly identical to each other, and share 55% amino acid identity with GSTT1. All three genes may play a role in human carcinogenesis. The GSTT2B gene is a pseudogene in some populations. [provided by RefSeq, Sep 2015]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

其它Glutathione S Transferase theta 2产品

Customer Reviews 
Loading...