United States
Germany
Japan
United Kingdom
China
PCBP2 (NM_001098620) Human Untagged Clone
CAT＃: SC316363
PCBP2 (untagged)-Human poly(rC) binding protein 2 (PCBP2), transcript variant 3
CNY 6,270.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | hnRNP-E2; HNRNPE2; HNRPE2 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC316363 representing NM_001098620.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGACACCGGTGTGATTGAAGGTGGATTAAATGTCACTCTCACCATCCGGCTACTTATGCATGGAAAG GAAGTTGGCAGTATCATCGGAAAGAAAGGAGAATCAGTTAAGAAGATGCGCGAGGAGAGTGGTGCACGT ATCAACATCTCAGAAGGGAATTGTCCTGAGAGAATTATCACTTTGGCTGGACCCACTAATGCCATCTTC AAAGCCTTTGCTATGATCATTGACAAACTGGAAGAGGACATAAGCAGCTCTATGACCAATAGCACAGCT GCCAGTAGACCCCCGGTCACCCTGAGGCTGGTGGTCCCTGCTAGTCAGTGTGGCTCTCTCATTGGAAAA GGTGGATGCAAGATCAAGGAAATACGAGAGAGTACAGGGGCTCAGGTCCAGGTGGCAGGGGATATGCTA CCCAACTCAACTGAGCGGGCCATCACTATTGCTGGCATTCCACAATCCATCATTGAGTGTGTCAAACAG ATCTGCGTGGTCATGTTGGAGTCCCCCCCGAAGGGCGTGACCATCCCGTACCGGCCCAAGCCGTCCAGC TCTCCGGTCATCTTTGCAGGTGGTCAGGCCTATACCATTCAAGGACAGTATGCCATTCCACAGCCAGAT TTGACCAAGCTGCACCAGTTGGCAATGCAACAGTCTCATTTTCCCATGACGCATGGCAACACCGGATTC AGTGGCATTGAATCCAGCTCTCCAGAGGTGAAAGGCTATTGGGCAGGTTTGGATGCATCTGCTCAGACT ACTTCTCATGAACTCACCATTCCAAACGATTTGATTGGCTGCATAATCGGGCGTCAAGGCGCCAAAATC AATGAGATCCGTCAGATGTCTGGGGCGCAGATCAAAATTGCGAACCCAGTGGAAGGATCTACTGATAGG CAGGTTACCATCACTGGATCTGCTGCCAGCATTAGCCTGGCTCAATATCTAATCAATGTCAGGCTTTCC TCGGAGACGGGTGGCATGGGGAGCAGCTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001098620 |
| Insert Size | 996 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001098620.2 |
| RefSeq Size | 3082 bp |
| RefSeq ORF | 996 bp |
| Locus ID | 5094 |
| UniProt ID | Q15366 |
| MW | 34.9 kDa |
| Gene Summary | The protein encoded by this gene appears to be multifunctional. Along with PCBP-1 and hnRNPK, it is one of the major cellular poly(rC)-binding proteins. The encoded protein contains three K-homologous (KH) domains which may be involved in RNA binding. Together with PCBP-1, this protein also functions as a translational coactivator of poliovirus RNA via a sequence-specific interaction with stem-loop IV of the IRES, promoting poliovirus RNA replication by binding to its 5'-terminal cloverleaf structure. It has also been implicated in translational control of the 15-lipoxygenase mRNA, human papillomavirus type 16 L2 mRNA, and hepatitis A virus RNA. The encoded protein is also suggested to play a part in formation of a sequence-specific alpha-globin mRNP complex which is associated with alpha-globin mRNA stability. This multiexon structural mRNA is thought to be retrotransposed to generate PCBP-1, an intronless gene with functions similar to that of PCBP2. This gene and PCBP-1 have paralogous genes (PCBP3 and PCBP4) which are thought to have arisen as a result of duplication events of entire genes. This gene also has two processed pseudogenes (PCBP2P1 and PCBP2P2). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2018] Transcript Variant: This variant (3) uses an alternate in-frame splice site and lacks an alternate in-frame exon compared to variant 1. The resulting isoform (c) has the same N- and C-termini but is shorter compared to isoform a. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC213289 | PCBP2 (Myc-DDK-tagged)-Human poly(rC) binding protein 2 (PCBP2), transcript variant 3 |
CNY 2,400.00 |
|
| RC213289L3 | Lenti ORF clone of Human poly(rC) binding protein 2 (PCBP2), transcript variant 3, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC213289L4 | Lenti ORF clone of Human poly(rC) binding protein 2 (PCBP2), transcript variant 3, mGFP tagged |
CNY 5,890.00 |
|
| RG213289 | PCBP2 (tGFP-tagged) - Human poly(rC) binding protein 2 (PCBP2), transcript variant 3 |
CNY 4,370.00 |
