FAM210A (NM_001098801) Human Untagged Clone

CAT#: SC316495

FAM210A (untagged)-Human chromosome 18 open reading frame 19 (C18orf19), transcript variant 1



  "NM_001098801" in other vectors (6)

CNY 2,400.00

CNY 6,270.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C18orf19; HsT2329
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF within SC100573 sequence for NM_152352 edited (data generated by NextGen Sequencing)
ATGCAATGGAATGTACCACGGACTGTATCTCGACTGGCACGCAGGACATGCTTGGAACCA
CATAATGCTGGTCTCTTTGGACACTGTCAAAATGTAAAGGGACCTTTACTTTTATACAAT
GCTGAATCCAAAGTGGTTTTGGTACAAGGCCCTCAAAAACAATGGTTGCATTTATCTGCT
GCCCAGTGTGTTGCAAAGGAAAGGAGGCCATTGGATGCTCATCCACCCCAACCAGGAGTC
CTTCGCCATAAGCAAGGGAAGCAACATGTTTCATTCAGGAGGGTTTTTTCATCCAGTGCC
ACAGCTCAGGGAACTCCGGAAAAAAAGGAAGAGCCTGATCCTTTGCAAGACAAATCTATT
AGTCTTTATCAACGATTCAAGAAGACATTTAGACAGTATGGAAAAGTTCTGATTCCAGTG
CATCTAATAACTTCTGGTGTTTGGTTTGGAACATTTTATTATGCAGCCTTGAAAGGAGTG
AATGTCGTTCCTTTTCTAGAACTCATTGGGTTACCTGACAGTGTGGTAAGCATCCTGAAA
AACTCCCAGAGTGGAAATGCCCTCACAGCATATGCCTTGTTTAAGATTGCAACACCTGCT
CGGTATACCGTGACTTTGGGAGGAACATCTGTCACTGTGAAGTATCTGCGCAGTCATGGC
TACATGTCCACGCCGCCACCCGTCAAGGAGTATCTGCAGGACAGGATGGAAGAGACAAAG
GAGCTTATCACAGAGAAAATGGAAGAAACAAAAGATAGACTCACTGAAAAGTTACAAGAA
ACCAAAGAAAAAGTTTCCTTTAAGAAAAAAGTGGAATAA

Clone variation with respect to NM_152352.3
Restriction Sites Please inquire     
ACCN NM_001098801
Insert Size 1800 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001098801.1, NP_001092271.1
RefSeq Size 4392 bp
RefSeq ORF 819 bp
Locus ID 125228
UniProt ID Q96ND0
Protein Families Transmembrane
Gene Summary May play a role in the structure and strength of both muscle and bone.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...