United States
Germany
Japan
United Kingdom
China
TMEM100 (NM_001099640) Human Untagged Clone
CAT＃: SC316652
TMEM100 (untagged)-Human transmembrane protein 100 (TMEM100), transcript variant 1
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC316652 representing NM_001099640.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGACTGAAGAGCCCATCAAGGAGATCCTGGGAGCCCCAAAGGCTCACATGGCAGCGACGATGGAGAAG AGCCCCAAGAGTGAAGTTGTGATCACCACAGTCCCTCTGGTCAGTGAGATTCAGTTGATGGCTGCTACA GGGGGTACCGAGCTCTCCTGCTACCGCTGCATCATCCCCTTTGCTGTGGTTGTCTTCATCGCCGGCATC GTGGTCACCGCGGTGGCTTACAGCTTCAATTCCCATGGGTCTATTATCTCCATCTTTGGCCTGGTTGTT CTGTCATCTGGACTTTTTTTACTAGCCTCCAGTGCCTTGTGCTGGAAAGTGAGACAAAGGAGCAAGAAA GCCAAGAGACGGGAGAGTCAAACAGCTCTCGTGGCAAATCAGAGAAGCTTGTTTGCTTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001099640 |
| Insert Size | 405 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001099640.1 |
| RefSeq Size | 2269 bp |
| RefSeq ORF | 405 bp |
| Locus ID | 55273 |
| UniProt ID | Q9NV29 |
| Protein Families | Transmembrane |
| MW | 14.4 kDa |
| Gene Summary | Plays a role during embryonic arterial endothelium differentiation and vascular morphogenesis through the ACVRL1 receptor-dependent signaling pathway upon stimulation by bone morphogenetic proteins, such as GDF2/BMP9 and BMP10. Involved in the regulation of nociception, acting as a modulator of the interaction between TRPA1 and TRPV1, two molecular sensors and mediators of pain signals in dorsal root ganglia (DRG) neurons. Mechanistically, it weakens their interaction, thereby releasing the inhibition of TRPA1 by TRPV1 and increasing the single-channel open probability of the TRPA1-TRPV1 complex.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longer transcript. Variants 1 and 2 both encode the same protein. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC223648 | TMEM100 (Myc-DDK-tagged)-Human transmembrane protein 100 (TMEM100), transcript variant 1 |
CNY 1,200.00 |
|
| RC223648L1 | Lenti ORF clone of Human transmembrane protein 100 (TMEM100), transcript variant 1, Myc-DDK-tagged |
CNY 3,600.00 |
|
| RC223648L2 | Lenti ORF clone of Human transmembrane protein 100 (TMEM100), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
| RC223648L3 | Lenti ORF clone of Human transmembrane protein 100 (TMEM100), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC223648L4 | Lenti ORF clone of Human transmembrane protein 100 (TMEM100), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
| RG223648 | TMEM100 (tGFP-tagged) - Human transmembrane protein 100 (TMEM100), transcript variant 1 |
CNY 4,370.00 |
其它TMEM100产品
