TMEM100 (NM_001099640) Human Untagged Clone

CAT#: SC316652

TMEM100 (untagged)-Human transmembrane protein 100 (TMEM100), transcript variant 1



  "NM_001099640" in other vectors (6)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TMEM100 mouse monoclonal antibody, clone OTI10G3 (formerly 10G3)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC316652 representing NM_001099640.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGACTGAAGAGCCCATCAAGGAGATCCTGGGAGCCCCAAAGGCTCACATGGCAGCGACGATGGAGAAG
AGCCCCAAGAGTGAAGTTGTGATCACCACAGTCCCTCTGGTCAGTGAGATTCAGTTGATGGCTGCTACA
GGGGGTACCGAGCTCTCCTGCTACCGCTGCATCATCCCCTTTGCTGTGGTTGTCTTCATCGCCGGCATC
GTGGTCACCGCGGTGGCTTACAGCTTCAATTCCCATGGGTCTATTATCTCCATCTTTGGCCTGGTTGTT
CTGTCATCTGGACTTTTTTTACTAGCCTCCAGTGCCTTGTGCTGGAAAGTGAGACAAAGGAGCAAGAAA
GCCAAGAGACGGGAGAGTCAAACAGCTCTCGTGGCAAATCAGAGAAGCTTGTTTGCTTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001099640
Insert Size 405 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001099640.1
RefSeq Size 2269 bp
RefSeq ORF 405 bp
Locus ID 55273
UniProt ID Q9NV29
Protein Families Transmembrane
MW 14.4 kDa
Gene Summary Plays a role during embryonic arterial endothelium differentiation and vascular morphogenesis through the ACVRL1 receptor-dependent signaling pathway upon stimulation by bone morphogenetic proteins, such as GDF2/BMP9 and BMP10. Involved in the regulation of nociception, acting as a modulator of the interaction between TRPA1 and TRPV1, two molecular sensors and mediators of pain signals in dorsal root ganglia (DRG) neurons. Mechanistically, it weakens their interaction, thereby releasing the inhibition of TRPA1 by TRPV1 and increasing the single-channel open probability of the TRPA1-TRPV1 complex.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longer transcript. Variants 1 and 2 both encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...