Neurotrophin 3 (NTF3) (NM_001102654) Human Untagged Clone
CAT#: SC316918
NTF3 (untagged)-Human neurotrophin 3 (NTF3), transcript variant 1
CNY 2,400.00
CNY 6,270.00
Cited in 1 publication. |
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | HDNF; NGF-2; NGF2; NT-3; NT3 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_001102654 edited
GCCATGGTTACTTTTGCCACGATCTTACAGGTGAACAAGGTGATGTCCATCTTGTTTTAT GTGATATTTCTCGCTTATCTCCGTGGCATCCAAGGTAACAACATGGATCAAAGGAGTTTG CCAGAAGACTCGCTCAATTCCCTCATTATTAAGCTGATCCAGGCAGATATTTTGAAAAAC AAGCTCTCCAAGCAGATGGTGGACGTTAAGGAAAATTACCAGAGCACCCTGCCCAAAGCT GAGGCTCCCCGAGAGCCGGAGCGGGGAGGGCCCGCCAAGTCAGCATTCCAGCCAGTGATT GCAATGGACACCGAACTGCTGCGACAACAGAGACGCTACAACTCACCGCGGGTCCTGCTG AGCGACAGCACCCCCTTGGAGCCCCCGCCCTTGTATCTCATGGAGGATTACGTGGGCAGC CCCGTGGTGGCGAACAGAACATCACGGCGGAAACGGTACGCGGAGCATAAGAGTCACCGA GGGGAGTACTCGGTATGTGACAGTGAGAGTCTGTGGGTGACCGACAAGTCATCGGCCATC GACATTCGGGGACACCAGGTCACGGTGCTGGGGGAGATCAAAACGGGCAACTCTCCTGTC AAACAATATTTTTATGAAACGCGATGTAAGGAAGCCAGGCCGGTCAAAAACGGTTGCAGG GGTATTGATGATAAACACTGGAACTCTCAGTGCAAAACATCCCAAACCTACGTCCGAGCA CTGACTTCAGAGAACAATAAACTCGTGGGCTGGCGGTGGATACGGATAGACACGTCCTGT GTGTGTGCCTTGTCGAGAAAAATCGGAAGAACATGAATTGGCATCTCTCCCCATATATAA ATTATTACTTTAAATTATATGATATGCATGTAGCATATAAATGTTTATATTGTTTTTATA TATTATAAGTTGACCTTTATTTATTAAACTTCAGCAACCCTACAGTATATAAGCTTTTTT CTCAATAAAATCAGTGTGCTTGCCTTCCCTCAGGCCTCTCCCATCT |
Restriction Sites | Please inquire |
ACCN | NM_001102654 |
Insert Size | 1000 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001102654.1. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001102654.1, NP_001096124.1 |
RefSeq Size | 1349 bp |
RefSeq ORF | 813 bp |
Locus ID | 4908 |
UniProt ID | P20783 |
Protein Families | Druggable Genome, Secreted Protein |
Protein Pathways | MAPK signaling pathway, Neurotrophin signaling pathway |
Gene Summary | The protein encoded by this gene is a member of the neurotrophin family, that controls survival and differentiation of mammalian neurons. This protein is closely related to both nerve growth factor and brain-derived neurotrophic factor. It may be involved in the maintenance of the adult nervous system, and may affect development of neurons in the embryo when it is expressed in human placenta. NTF3-deficient mice generated by gene targeting display severe movement defects of the limbs. The mature peptide of this protein is identical in all mammals examined including human, pig, rat and mouse. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) encodes the longer isoform (1). |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
CARP-1 Functional Mimetics: A Novel Class of Small Molecule Inhibitors of Medulloblastoma Cell Growth
,null,
PLoS ONE
,PubMed ID 23826121
[NTF3]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC214281 | NTF3 (Myc-DDK-tagged)-Human neurotrophin 3 (NTF3), transcript variant 1 |
CNY 2,400.00 |
|
RC214281L1 | Lenti ORF clone of Human neurotrophin 3 (NTF3), transcript variant 1, Myc-DDK-tagged |
CNY 4,800.00 |
|
RC214281L2 | Lenti ORF clone of Human neurotrophin 3 (NTF3), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RC214281L3 | Lenti ORF clone of Human neurotrophin 3 (NTF3), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC214281L4 | Lenti ORF clone of Human neurotrophin 3 (NTF3), transcript variant 1, mGFP tagged |
CNY 4,800.00 |
|
RG214281 | NTF3 (tGFP-tagged) - Human neurotrophin 3 (NTF3), transcript variant 1 |
CNY 4,000.00 |
其它Neurotrophin 3产品