Epsin 2 (EPN2) (NM_001102664) Human Untagged Clone

CAT#: SC316927

EPN2 (untagged)-Human epsin 2 (EPN2), transcript variant 3



  "NM_001102664" in other vectors (4)

CNY 7,220.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
EPN2 (Epsin 2) mouse monoclonal antibody, clone OTI1C2 (formerly 1C2)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms EHB21
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC316927 representing NM_001102664.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAGCAGAGAAGTGGCTGAGCAGGAAGAACGCCTCAGGCGGGGTGATGACCTCAGATTACAGATGGCC
CTGGAAGAAAGCCGAAGGGACACAGTTAAAATTCCAAAAAAGAAAGAGCATGGCTCTCTCCCACAGCAG
ACTACGCTGTTGGATTTAATGGATGCTCTCCCCAGCTCGGGCCCCGCGGCCCAGAAAGCAGAGCCCTGG
GGCCCGTCAGCCTCCACTAACCAGACCAACCCCTGGGGCGGGCCAGCGGCTCCTGCGAGTACTTCAGAC
CCCTGGCCATCGTTTGGTACCAAGCCAGCTGCCTCCATTGACCCATGGGGGGTGCCCACTGGAGCCACC
GTACAATCTGTCCCCAAGAACTCGGACCCCTGGGCAGCTTCACAGCAGCCTGCCTCCAGTGCTGGGAAA
AGAGCTTCTGACGCGTGGGGCGCAGTCTCCACCACCAAGCCCGTGTCTGTCTCTGGGTCCTTTGAGCTC
TTCAGTAATCTGAATGGTACAATTAAAGATGACTTTTCTGAATTTGACAACCTTCGGACTTCAAAAAAA
ACAGCCGAATCTGTGACCTCTCTGCCATCCCAAAACAATGGAACTACCAGCCCTGACCCCTTTGAGTCT
CAACCCCTGACTGTCGCCTCAAGCAAGCCCAGCAGTGCCCGGAAAACACCTGAGTCCTTCCTGGGCCCC
AACGCGGCCCTGGTGAACCTGGACTCACTGGTGACCAGGCCTGCCCCACCAGCCCAGTCCCTCAACCCT
TTCCTGGCACCAGGTGCTCCCGCCACCTCGGCCCCTGTTAACCCTTTCCAGGTGAACCAGCCCCAGCCG
CTGACACTGAACCAGCTTCGGGGGAGCCCAGTCCTGGGGACCAGCACATCCTTTGGGCCTGGCCCAGGA
GTGGAGTCCATGGCTGTGGCCTCGATGACCTCCGCGGCCCCACAGCCAGCTCTGGGGGCCACTGGTTCC
TCTCTGACACCACTGGGCCCTGCAATGATGAACATGGTGGGCAGTGTGGGTATACCCCCATCAGCAGCC
CAGGCCACTGGCACAACCAACCCTTTCCTTCTCTAG

AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGAT
ATCCTGGATTACAAGGATGACGACGATAAG
GTTTAA
Restriction Sites SgfI-RsrII     
ACCN NM_001102664
Insert Size 1071 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001102664.1
RefSeq Size 3776 bp
RefSeq ORF 1071 bp
Locus ID 22905
UniProt ID O95208
Protein Pathways Endocytosis
MW 36.7 kDa
Gene Summary This gene encodes a protein which interacts with clathrin and adaptor-related protein complex 2, alpha 1 subunit. The protein is found in a brain-derived clathrin-coated vesicle fraction and localizes to the peri-Golgi region and the cell periphery. The protein is thought to be involved in clathrin-mediated endocytosis. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (3) differs in the 5' UTR and coding region compared to variant 2. The resulting isoform (c) is shorter at the N-terminus compared to isoform b. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...