ELOVL7 (NM_001104558) Human Untagged Clone
CAT#: SC317051
ELOVL7 (untagged)-Human ELOVL fatty acid elongase 7 (ELOVL7), transcript variant 2
CNY 3,600.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC317051 representing NM_001104558.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCCTTCAGTGATCTTACATCGAGGACTGTGCATCTTTATGATAATTGGATCAAAGATGCTGATCCA AGAGTTGAAGATTGGCTCCTCATGTCCTCGCCTCTGCCACAAACCATCCTCCTAGGATTCTATGTCTAT TTTGTCACTTCCTTGGGACCAAAGCTCATGGAAAATCGCAAGCCCTTTGAACTCAAGAAAGCAATGATA ACGTACAATTTTTTCATAGTACTCTTTTCTGTGTATATGTGTTATGAGTTTGTGATGTCTGGCTGGGGT ATAGGTTATTCATTTCGATGTGACATTGTTGACTATTCACGGTCACCCACAGCTTTGAGGATGGCACGT ACCTGCTGGCTTTATTACTTCTCCAAATTTATTGAGCTATTAGATACGATCTTTTTTGTTCTGCGCAAG AAAAATAGCCAAGTGACTTTCCTTCATGTATTCCATCATACCATCATGCCGTGGACCTGGTGGTTTGGA GTCAAATTTGCTGCAGGTGGTTTGGGAACATTCCATGCCCTTCTAAATACAGCTGTACATGTAGTCATG TATTCCTACTATGGACTTTCTGCATTGGGGCCAGCCTACCAGAAGTATTTGTGGTGGAAAAAATATTTG ACATCATTACAGCTTGTCCAGTTTGTTATTGTCGCCATCCACATAAGCCAGTTCTTTTTCATGGAGGAT TGCAAGTATCAGTTTCCAGTCTTTGCGTGCATCATTATGAGTTACAGTTTCATGTTTCTGCTGCTCTTT CTCCATTTTTGGTACCGTGCTTACACCAAAGGTCAGAGGTTGCCCAAAACTGTGAAAAATGGAACTTGC AAAAACAAAGATAATTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001104558 |
Insert Size | 846 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001104558.1 |
RefSeq Size | 3851 bp |
RefSeq ORF | 846 bp |
Locus ID | 79993 |
UniProt ID | A1L3X0 |
Protein Families | Transmembrane |
MW | 33.4 kDa |
Gene Summary | Catalyzes the first and rate-limiting reaction of the four reactions that constitute the long-chain fatty acids elongation cycle. This endoplasmic reticulum-bound enzymatic process allows the addition of 2 carbons to the chain of long- and very long-chain fatty acids (VLCFAs) per cycle. Condensing enzyme with higher activity toward C18 acyl-CoAs, especially C18:3(n-3) acyl-CoAs and C18:3(n-6)-CoAs. Also active toward C20:4-, C18:0-, C18:1-, C18:2- and C16:0-CoAs, and weakly toward C20:0-CoA. Little or no activity toward C22:0-, C24:0-, or C26:0-CoAs. May participate in the production of saturated and polyunsaturated VLCFAs of different chain lengths that are involved in multiple biological processes as precursors of membrane lipids and lipid mediators.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same isoform. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225384 | ELOVL7 (Myc-DDK-tagged)-Human ELOVL fatty acid elongase 7 (ELOVL7), transcript variant 2 |
CNY 3,600.00 |
|
RC225384L3 | Lenti ORF clone of Human ELOVL fatty acid elongase 7 (ELOVL7), transcript variant 2, Myc-DDK-tagged |
CNY 6,000.00 |
|
RC225384L4 | Lenti ORF clone of Human ELOVL fatty acid elongase 7 (ELOVL7), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG225384 | ELOVL7 (tGFP-tagged) - Human ELOVL fatty acid elongase 7 (ELOVL7), transcript variant 2 |
CNY 4,370.00 |