PIN4 (NM_006223) Human Untagged Clone
CAT#: SC317253
PIN4 (untagged)-Human protein (peptidylprolyl cis/trans isomerase) NIMA-interacting, 4 (parvulin) (PIN4), nuclear gene encoding mitochondrial protein, transcript variant 1
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | EPVH; PAR14; PAR17 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC317253 representing NM_006223.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCCCATGGCGGGGCTTCTAAAGGGGCTTGTACGGCAACTGGAGCGGTTCAGCGTTCAACAACAAGCT TCCAAGATGCCGCCCAAAGGAAAAAGTGGTTCTGGAAAAGCGGGGAAAGGGGGAGCAGCCTCTGGGAGT GACAGTGCTGACAAGAAGGCTCAAGGTCCCAAAGGTGGTGGCAATGCAGTAAAGGTCAGACACATTCTA TGTGAAAAACATGGCAAAATCATGGAAGCCATGGAAAAGTTAAAGTCTGGGATGAGATTCAATGAAGTG GCCGCACAGTATAGTGAAGATAAAGCCAGGCAAGGGGGTGACTTGGGTTGGATGACCAGAGGGTCCATG GTGGGACCATTTCAAGAAGCAGCATTTGCCTTGCCTGTAAGTGGGATGGATAAGCCTGTGTTTACAGAC CCACCGGTTAAGACAAAATTTGGATATCATATTATTATGGTCGAAGGAAGAAAATAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_006223 |
Insert Size | 471 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_006223.3 |
RefSeq Size | 1331 bp |
RefSeq ORF | 471 bp |
Locus ID | 5303 |
UniProt ID | Q9Y237 |
Domains | Rotamase |
MW | 16.6 kDa |
Gene Summary | This gene encodes a member of the parvulin subfamily of the peptidyl-prolyl cis/trans isomerase protein family. The encoded protein catalyzes the isomerization of peptidylprolyl bonds, and may play a role in the cell cycle, chromatin remodeling, and/or ribosome biogenesis. The encoded protein may play an additional role in the mitochondria. [provided by RefSeq, Dec 2009] Transcript Variant: This variant (1) encodes isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. CCDS Note: The coding region has been updated to start at a downstream alternate in-frame start codon that is supported by conservation data. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC210802 | PIN4 (Myc-DDK-tagged)-Human protein (peptidylprolyl cis/trans isomerase) NIMA-interacting, 4 (parvulin) (PIN4), nuclear gene encoding mitochondrial protein, transcript variant 1 |
CNY 1,200.00 |
|
RC210802L1 | Lenti ORF clone of Human protein (peptidylprolyl cis/trans isomerase) NIMA-interacting, 4 (parvulin) (PIN4), nuclear gene encoding mitochondrial protein, transcript variant 1, Myc-DDK-tagged |
CNY 3,600.00 |
|
RC210802L2 | Lenti ORF clone of Human protein (peptidylprolyl cis/trans isomerase) NIMA-interacting, 4 (parvulin) (PIN4), nuclear gene encoding mitochondrial protein, transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RC210802L3 | Lenti ORF clone of Human protein (peptidylprolyl cis/trans isomerase) NIMA-interacting, 4 (parvulin) (PIN4), nuclear gene encoding mitochondrial protein, transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC210802L4 | Lenti ORF clone of Human protein (peptidylprolyl cis/trans isomerase) NIMA-interacting, 4 (parvulin) (PIN4), nuclear gene encoding mitochondrial protein, transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RG210802 | PIN4 (tGFP-tagged) - Human protein (peptidylprolyl cis/trans isomerase) NIMA-interacting, 4 (parvulin) (PIN4), nuclear gene encoding mitochondrial protein, transcript variant 1 |
CNY 2,800.00 |
|
SC116230 | PIN4 (untagged)-Human protein (peptidylprolyl cis/trans isomerase) NIMA-interacting, 4 (parvulin) (PIN4), nuclear gene encoding mitochondrial protein, transcript variant 1 |
CNY 1,200.00 |