CHMP4A (NM_014169) Human Untagged Clone

CAT#: SC317381

CHMP4A (untagged)-Human chromatin modifying protein 4A (CHMP4A)



  "NM_014169" in other vectors (7)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
CHMP4A Antibody - C-terminal region
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C14orf123; CHMP4; CHMP4B; HSPC134; SHAX2; SNF7; SNF7-1; VPS32-1; VPS32A
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC317381 representing NM_014169.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTCGCGGCGGCGCCCTGAGGACGGATTGGGCAAGGCTGGTCCCTGTGTGATGAGACATCACCCTCCC
AGGAGCAAGGCGGAAGTCTGGAGGACGCTGAGGGGCGGAGGCGGGAGAGGCGAGCTCGCGATGAGTGGT
CTCGGCAGGCTCTTCGGGAAGGGGAAGAAGGAGAAAGGGCCAACCCCTGAAGAAGCAATACAGAAACTG
AAGGAGACAGAGAAGATACTGATCAAGAAACAGGAATTTTTGGAGCAGAAGATTCAACAGGAGCTACAA
ACAGCCAAGAAGTATGGGACCAAGAATAAGAGAGCTGCCCTACAGGCTTTGCGGAGGAAGAAAAGATTC
GAACAGCAGCTGGCACAAACTGACGGGACATTATCCACCCTGGAGTTTCAGCGTGAGGCCATTGAGAAT
GCCACTACCAATGCAGAAGTCCTTCGTACCATGGAGCTTGCTGCCCAAAGCATGAAGAAGGCCTACCAG
GACATGGACATTGACAAGGTAGATGAACTGATGACTGACATCACGGAACAACAGGAGGTGGCCCAGCAG
ATCTCAGATGCCATTTCTCGGCCTATGGGCTTTGGAGATGATGTGGATGAGGATGAACTGCTGGAGGAG
CTAGAGGAGCTGGAGCAGGAGGAATTGGCCCAGGAGTTGTTAAATGTGGGCGACAAGGAAGAAGAACCC
TCAGTCAAATTGCCTAGTGTACCTTCTACTCATCTGCCGGCAGGGCCAGCTCCCAAAGTGGATGAAGAT
GAAGAAGCACTAAAGCAGTTGGCTGAGTGGGTATCCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_014169
Insert Size 798 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_014169.3
RefSeq Size 1372 bp
RefSeq ORF 798 bp
Locus ID 29082
UniProt ID Q9BY43
Domains DUF279
Protein Pathways Endocytosis
MW 29.8 kDa
Gene Summary CHMP4A belongs to the chromatin-modifying protein/charged multivesicular body protein (CHMP) family. These proteins are components of ESCRT-III (endosomal sorting complex required for transport III), a complex involved in degradation of surface receptor proteins and formation of endocytic multivesicular bodies (MVBs). Some CHMPs have both nuclear and cytoplasmic/vesicular distributions, and one such CHMP, CHMP1A (MIM 164010), is required for both MVB formation and regulation of cell cycle progression (Tsang et al., 2006 [PubMed 16730941]).[supplied by OMIM, Mar 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...