United States
Germany
Japan
United Kingdom
China
Kallikrein 14 (KLK14) (NM_022046) Human Untagged Clone
CAT＃: SC317386
KLK14 (untagged)-Human kallikrein-related peptidase 14 (KLK14)
CNY 6,270.00
| Cited in 1 publication. |
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | KLK-L6 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC317386 representing NM_022046.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTCCCTGAGGGTCTTGGGCTCTGGGACCTGGCCCTCAGCCCCTAAAATGTTCCTCCTGCTGACAGCA CTTCAAGTCCTGGCTATAGCCATGACACAGAGCCAAGAGGATGAGAACAAGATAATTGGTGGCCATACG TGCACCCGGAGCTCCCAGCCGTGGCAGGCGGCCCTGCTGGCGGGTCCCAGGCGCCGCTTCCTCTGCGGA GGCGCCCTGCTTTCAGGCCAGTGGGTCATCACTGCTGCTCACTGCGGCCGCCCGATCCTTCAGGTTGCC CTGGGCAAGCACAACCTGAGGAGGTGGGAGGCCACCCAGCAGGTGCTGCGCGTGGTTCGTCAGGTGACG CACCCCAACTACAACTCCCGGACCCACGACAACGACCTCATGCTGCTGCAGCTACAGCAGCCCGCACGG ATCGGGAGGGCAGTCAGGCCCATTGAGGTCACCCAGGCCTGTGCCAGCCCCGGGACCTCCTGCCGAGTG TCAGGCTGGGGAACTATATCCAGCCCCATCGCCAGGTACCCCGCCTCTCTGCAATGCGTGAACATCAAC ATCTCCCCGGATGAGGTGTGCCAGAAGGCCTATCCTAGAACCATCACGCCTGGCATGGTCTGTGCAGGA GTTCCCCAGGGCGGGAAGGACTCTTGTCAGGGTGACTCTGGGGGACCCCTGGTGTGCAGAGGACAGCTC CAGGGCCTCGTGTCTTGGGGAATGGAGCGCTGCGCCCTGCCTGGCTACCCCGGTGTCTACACCAACCTG TGCAAGTACAGAAGCTGGATTGAGGAAACGATGCGGGACAAATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_022046 |
| Insert Size | 804 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_022046.5 |
| RefSeq Size | 1022 bp |
| RefSeq ORF | 804 bp |
| Locus ID | 43847 |
| UniProt ID | Q9P0G3 |
| Protein Families | Druggable Genome, Protease, Secreted Protein |
| MW | 29.1 kDa |
| Gene Summary | This gene encodes a member of the kallikrein subfamily of serine proteases that have diverse physiological functions such as regulation of blood pressure and desquamation. The altered expression of this gene is implicated in the progression of different cancers including breast and prostate tumors. The encoded protein is a precursor that is proteolytically processed to generate the functional enzyme. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2015] Transcript Variant: This variant (2) differs in the 3' UTR compared to variant 1. Variants 1-3 all encode the same protein. |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Transgenic kallikrein 14 mice display major hair shaft defects associated with desmoglein 3 and 4 degradation, abnormal epidermal differentiation and Il-36 signature
,Gouin, O;Barbieux, C;Leturcq, F;Bonnet des Claustres, M;Petrova, E;Hovnanian, A;,
J. Invest. Dermatol.
,PubMed ID 32169475
[KLK14]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC219028 | KLK14 (Myc-DDK-tagged)-Human kallikrein-related peptidase 14 (KLK14) |
CNY 3,600.00 |
|
| RC219028L1 | Lenti ORF clone of Human kallikrein-related peptidase 14 (KLK14), Myc-DDK-tagged |
CNY 6,000.00 |
|
| RC219028L2 | Lenti ORF clone of Human kallikrein-related peptidase 14 (KLK14), mGFP tagged |
CNY 5,890.00 |
|
| RC219028L3 | Lenti ORF clone of Human kallikrein-related peptidase 14 (KLK14), Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC219028L4 | Lenti ORF clone of Human kallikrein-related peptidase 14 (KLK14), mGFP tagged |
CNY 5,890.00 |
|
| RG219028 | KLK14 (tGFP-tagged) - Human kallikrein-related peptidase 14 (KLK14) |
CNY 5,200.00 |
|
| SC123983 | KLK14 (untagged)-Human kallikrein-related peptidase 14 (KLK14) |
CNY 3,600.00 |
其它Kallikrein 14产品
