SLC25A26 (NM_173471) Human Untagged Clone
CAT#: SC317395
SLC25A26 (untagged)-Human solute carrier family 25, member 26 (SLC25A26), nuclear gene encoding mitochondrial protein, transcript variant 1
CNY 6,270.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | COXPD28; SAMC |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC317395 representing NM_173471.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGACCGGCCGGGGTTCGTGGCAGCGCTGGTGGCTGGTGGGGTAGCAGGTGTTTCTGTTGACTTGATA TTATTTCCTCTGGATACCATTAAAACCAGGCTGCAGAGTCCCCAAGGATTTAGTAAGGCTGGTGGTTTT CATGGAATATATGCTGGCGTTCCTTCTGCTGCTATTGGATCCTTTCCTAATGCTGCTGCATTTTTTATC ACCTATGAATATGTGAAGTGGTTTTTGCATGCTGATTCATCTTCATATTTGACACCTATGAAACATATG TTGGCTGCCTCTGCTGGAGAAGTGGTTGCCTGCCTGATTCGAGTTCCATCTGAAGTGGTTAAGCAGAGG GCACAGGTATCTGCTTCTACAAGAACATTTCAGATTTTCTCTAACATCTTATATGAAGAGGGTATCCAA GGGTTGTATCGAGGCTATAAAAGCACAGTTTTAAGAGAGATTCCTTTTTCTTTGGTCCAGTTTCCCTTA TGGGAGTCCTTAAAAGCCCTCTGGTCCTGGAGGCAGGATCATGTGGTGGATTCTTGGCAGTCAGCAGTC TGTGGAGCTTTTGCAGGTGGATTTGCCGCTGCAGTCACCACCCCTCTAGACGTGGCAAAGACAAGAATT ACGCTGGCAAAGGCTGGCTCCAGCACTGCTGATGGGAATGTGCTCTCTGTCCTGCATGGGGTCTGGCGG TCACAGGGGCTGGCAGGATTATTTGCAGGTGTCTTCCCTCGAATGGCAGCCATCAGTCTGGGAGGTTTC ATCTTTCTGGGGGCTTATGACCGAACGCACAGCTTGCTGTTGGAAGTTGGCAGAAAGAGTCCTTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_173471 |
Insert Size | 825 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_173471.3 |
RefSeq Size | 2686 bp |
RefSeq ORF | 825 bp |
Locus ID | 115286 |
UniProt ID | Q70HW3 |
MW | 29.4 kDa |
Gene Summary | This gene is a member of the mitochondrial carrier family which includes nuclear-encoded transporters localized on the inner mitochondrial membranes. Members of the family transport important small molecules across the mitochondrial inner membrane. This protein is involved in the transport of S-adenosylmethionine (SAM) into the mitochondria. Mutations in this gene are associated with combined oxidative phosphorylation deficiency 28. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2017] Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC216404 | SLC25A26 (Myc-DDK-tagged)-Human solute carrier family 25, member 26 (SLC25A26), nuclear gene encoding mitochondrial protein, transcript variant 1 |
CNY 2,400.00 |
|
RC216404L3 | Lenti ORF clone of Human solute carrier family 25, member 26 (SLC25A26), nuclear gene encoding mitochondrial protein, transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC216404L4 | Lenti ORF clone of Human solute carrier family 25, member 26 (SLC25A26), nuclear gene encoding mitochondrial protein, transcript variant 1, mGFP tagged |
CNY 4,800.00 |
|
RG216404 | SLC25A26 (tGFP-tagged) - Human solute carrier family 25, member 26 (SLC25A26), nuclear gene encoding mitochondrial protein, transcript variant 1 |
CNY 4,000.00 |
|
SC108331 | SLC25A26 (untagged)-Human solute carrier family 25, member 26 (SLC25A26), nuclear gene encoding mitochondrial protein, transcript variant 1 |
CNY 6,270.00 |
其它SLC25A26产品