SLC25A26 (NM_173471) Human Untagged Clone

CAT#: SC317395

SLC25A26 (untagged)-Human solute carrier family 25, member 26 (SLC25A26), nuclear gene encoding mitochondrial protein, transcript variant 1



  "NM_173471" in other vectors (5)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-SLC25A26 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms COXPD28; SAMC
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC317395 representing NM_173471.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGACCGGCCGGGGTTCGTGGCAGCGCTGGTGGCTGGTGGGGTAGCAGGTGTTTCTGTTGACTTGATA
TTATTTCCTCTGGATACCATTAAAACCAGGCTGCAGAGTCCCCAAGGATTTAGTAAGGCTGGTGGTTTT
CATGGAATATATGCTGGCGTTCCTTCTGCTGCTATTGGATCCTTTCCTAATGCTGCTGCATTTTTTATC
ACCTATGAATATGTGAAGTGGTTTTTGCATGCTGATTCATCTTCATATTTGACACCTATGAAACATATG
TTGGCTGCCTCTGCTGGAGAAGTGGTTGCCTGCCTGATTCGAGTTCCATCTGAAGTGGTTAAGCAGAGG
GCACAGGTATCTGCTTCTACAAGAACATTTCAGATTTTCTCTAACATCTTATATGAAGAGGGTATCCAA
GGGTTGTATCGAGGCTATAAAAGCACAGTTTTAAGAGAGATTCCTTTTTCTTTGGTCCAGTTTCCCTTA
TGGGAGTCCTTAAAAGCCCTCTGGTCCTGGAGGCAGGATCATGTGGTGGATTCTTGGCAGTCAGCAGTC
TGTGGAGCTTTTGCAGGTGGATTTGCCGCTGCAGTCACCACCCCTCTAGACGTGGCAAAGACAAGAATT
ACGCTGGCAAAGGCTGGCTCCAGCACTGCTGATGGGAATGTGCTCTCTGTCCTGCATGGGGTCTGGCGG
TCACAGGGGCTGGCAGGATTATTTGCAGGTGTCTTCCCTCGAATGGCAGCCATCAGTCTGGGAGGTTTC
ATCTTTCTGGGGGCTTATGACCGAACGCACAGCTTGCTGTTGGAAGTTGGCAGAAAGAGTCCTTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_173471
Insert Size 825 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_173471.3
RefSeq Size 2686 bp
RefSeq ORF 825 bp
Locus ID 115286
UniProt ID Q70HW3
MW 29.4 kDa
Gene Summary This gene is a member of the mitochondrial carrier family which includes nuclear-encoded transporters localized on the inner mitochondrial membranes. Members of the family transport important small molecules across the mitochondrial inner membrane. This protein is involved in the transport of S-adenosylmethionine (SAM) into the mitochondria. Mutations in this gene are associated with combined oxidative phosphorylation deficiency 28. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2017]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...