C1QC (NM_001114101) Human Untagged Clone

CAT#: SC318803

C1QC (untagged)-Human complement component 1, q subcomponent, C chain (C1QC), transcript variant 1



  "NM_001114101" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit polyclonal C1QC Antibody (Center)
    • 400 ul

CNY 6,160.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C1Q-C; C1QG
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC318803 representing NM_001114101.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGACGTGGGGCCCAGCTCCCTGCCCCACCTTGGGCTGAAGCTGCTGCTGCTCCTGCTGCTGCTGCCC
CTCAGGGGCCAAGCCAACACAGGCTGCTACGGGATCCCAGGGATGCCCGGCCTGCCCGGGGCACCAGGG
AAGGATGGGTACGACGGACTGCCGGGGCCCAAGGGGGAGCCAGGAATCCCAGCCATTCCCGGGATCCGA
GGACCCAAAGGGCAGAAGGGAGAACCCGGCTTACCCGGCCATCCTGGGAAAAATGGCCCCATGGGACCC
CCTGGGATGCCAGGGGTGCCCGGCCCCATGGGCATCCCTGGAGAGCCAGGTGAGGAGGGCAGATACAAG
CAGAAATTCCAGTCAGTGTTCACGGTCACTCGGCAGACCCACCAGCCCCCTGCACCCAACAGCCTGATC
AGATTCAACGCGGTCCTCACCAACCCGCAGGGAGATTATGACACGAGCACTGGCAAGTTCACCTGCAAA
GTCCCCGGCCTCTACTACTTTGTCTACCACGCGTCGCATACAGCCAACCTGTGCGTGCTGCTGTACCGC
AGCGGCGTCAAAGTGGTCACCTTCTGTGGCCACACGTCCAAAACCAATCAGGTCAACTCGGGCGGTGTG
CTGCTGAGGTTGCAGGTGGGCGAGGAGGTGTGGCTGGCTGTCAATGACTACTACGACATGGTGGGCATC
CAGGGCTCTGACAGCGTCTTCTCCGGCTTCCTGCTCTTCCCCGACTAG

AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGAT
ATCCTGGATTACAAGGATGACGACGATAAG
GTTTAA
Restriction Sites SgfI-RsrII     
ACCN NM_001114101
Insert Size 738 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001114101.1
RefSeq Size 1205 bp
RefSeq ORF 738 bp
Locus ID 714
UniProt ID P02747
Protein Families Secreted Protein
Protein Pathways Complement and coagulation cascades, Prion diseases, Systemic lupus erythematosus
MW 25.8 kDa
Gene Summary This gene encodes the C-chain polypeptide of serum complement subcomponent C1q, which associates with C1r and C1s to yield the first component of the serum complement system. C1q is composed of 18 polypeptide chains which include 6 A-chains, 6 B-chains, and 6 C-chains. Each chain contains an N-terminal collagen-like region and a C-terminal C1q globular domain. C1q deficiency is associated with lupus erythematosus and glomerulonephritis. [provided by RefSeq, Dec 2016]
Transcript Variant: This variant (1) encodes the longer isoform (1). Variants 1-3 encode the same isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...