CLIC5 (NM_001114086) Human Untagged Clone
CAT#: SC318862
CLIC5 (untagged)-Human chloride intracellular channel 5 (CLIC5), nuclear gene encoding mitochondrial protein, transcript variant 1
CNY 3,656.00
CNY 6,650.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | DFNB102; DFNB103; MST130; MSTP130 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001114086, the custom clone sequence may differ by one or more nucleotides
ATGAATGACGAAGACTACAGCACCATCTATGACACAATCCAAAATGAGAGGACGTATGAGGTTCCAGACC AGCCAGAAGAAAATGAAAGTCCCCATTATGATGATGTCCATGAGTACTTAAGGCCAGAAAATGATTTATA TGCCACTCAGCTGAATACCCATGAGTATGATTTTGTGTCAGTCTATACCATTAAGGGTGAAGAGACCAGC TTGGCCTCTGTCCAGTCAGAAGACAGAGGCTACCTCCTGCCTGATGAGATATACTCTGAACTCCAGGAGG CTCATCCAGGTGAGCCCCAGGAGGACAGGGGCATCTCAATGGAAGGGTTATATTCATCAACCCAGGACCA GCAACTCTGCGCAGCAGAACTCCAGGAGAATGGGAGTGTGATGAAGGAAGATCTGCCTTCTCCTTCAAGC TTCACCATTCAGCACAGTAAGGCCTTCTCTACCACCAAGTATTCCTGCTATTCTGATGCTGAAGGTTTGG AAGAAAAGGAGGGAGCTCACATGAACCCTGAGATTTACCTCTTTGTGAAGGCTGGAATCGATGGAGAAAG CATCGGCAACTGTCCTTTCTCTCAGCGCCTCTTCATGATCCTCTGGCTGAAAGGAGTCGTGTTCAATGTC ACCACTGTGGATCTGAAAAGAAAGCCAGCTGACCTGCACAACCTAGCCCCCGGCACGCACCCGCCCTTCC TGACCTTCAACGGGGACGTGAAGACAGACGTCAATAAGATCGAGGAGTTCCTGGAGGAGACCTTGACCCC TGAAAAGTACCCCAAACTGGCTGCAAAACACCGGGAATCCAACACAGCGGGCATCGACATCTTTTCCAAG TTTTCTGCCTACATCAAAAATACCAAGCAGCAGAACAATGCTGCTCTTGAAAGAGGCCTAACCAAGGCTC TAAAGAAATTGGATGACTACCTGAACACCCCTCTACCAGAGGAGATTGACGCCAACACTTGTGGGGAAGA CAAGGGGTCCCGGCGCAAGTTCCTGGATGGGGATGAGCTGACCCTGGCTGACTGCAATCTGTTGCCCAAG CTCCATGTGGTCAAGATTGTGGCCAAGAAATACCGCAACTATGATATCCCGGCTGAGATGACAGGCCTGT GGCGGTACCTCAAGAACGCCTATGCCCGTGATGAGTTCACCAACACCTGTGCAGCTGACAGTGAGATCGA GTTGGCCTACGCTGATGTCGCCAAACGCCTCAGCCGATCCTGA |
Restriction Sites | Please inquire |
ACCN | NM_001114086 |
Insert Size | 1260 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001114086.1, NP_001107558.1 |
RefSeq Size | 5988 bp |
RefSeq ORF | 1233 bp |
Locus ID | 53405 |
UniProt ID | Q9NZA1 |
Protein Families | Druggable Genome, Ion Channels: Other |
Gene Summary | This gene encodes a member of the chloride intracellular channel (CLIC) family of chloride ion channels. The encoded protein associates with actin-based cytoskeletal structures and may play a role in multiple processes including hair cell stereocilia formation, myoblast proliferation and glomerular podocyte and endothelial cell maintenance. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011] Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (a, also known as also known as CLIC5B). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225641 | CLIC5 (Myc-DDK-tagged)-Human chloride intracellular channel 5 (CLIC5), nuclear gene encoding mitochondrial protein, transcript variant 1 |
CNY 3,656.00 |
|
RC225641L1 | Lenti-ORF clone of CLIC5 (Myc-DDK-tagged)-Human chloride intracellular channel 5 (CLIC5), nuclear gene encoding mitochondrial protein, transcript variant 1 |
CNY 5,890.00 |
|
RC225641L2 | Lenti-ORF clone of CLIC5 (mGFP-tagged)-Human chloride intracellular channel 5 (CLIC5), nuclear gene encoding mitochondrial protein, transcript variant 1 |
CNY 6,056.00 |
|
RC225641L3 | Lenti-ORF clone of CLIC5 (Myc-DDK-tagged)-Human chloride intracellular channel 5 (CLIC5), nuclear gene encoding mitochondrial protein, transcript variant 1 |
CNY 6,056.00 |
|
RC225641L4 | Lenti-ORF clone of CLIC5 (mGFP-tagged)-Human chloride intracellular channel 5 (CLIC5), nuclear gene encoding mitochondrial protein, transcript variant 1 |
CNY 5,890.00 |
|
RG225641 | CLIC5 (tGFP-tagged) - Human chloride intracellular channel 5 (CLIC5), nuclear gene encoding mitochondrial protein, transcript variant 1 |
CNY 5,256.00 |