United States
Germany
Japan
United Kingdom
China
E2F1 (NM_005225) Human Untagged Clone
CAT＃: SC318877
E2F1 (untagged)-Human E2F transcription factor 1 (E2F1)
CNY 5,488.00
| Cited in 3 publications. |
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | E2F-1; RBAP1; RBBP3; RBP3 |
| Vector | pCMV6-XL6 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene ORF sequence for NM_005225 edited
ATGGCCTTGGCCGGGGCCCCTGCGGGCGGCCCATGCGCGCCGGCGCTGGAGGCCCTGCTC GGGGCCGGCGCGCTGCGGCTGCTCGACTCCTCGCAGATCGTCATCATCTCCGCCGCGCAG GACGCCAGCGCCCCGCCGGCTCCCACCGGCCCCGCGGCGCCCGCCGCCGGCCCCTGCGAC CCTGACCTGCTGCTCTTCGCCACACCGCAGGCGCCCCGGCCCACACCCAGTGCGCCGCGG CCCGCGCTCGGCCGCCCGCCGGTGAAGCGGAGGCTGGACCTGGAAACTGACCATCAGTAC CTGGCCGAGAGCAGTGGGCCAGCTCGGGGCAGAGGCCGCCATCCAGGAAAAGGTGTGAAA TCCCCGGGGGAGAAGTCACGCTATGAGACCTCACTGAATCTGACCACCAAGCGCTTCCTG GAGCTGCTGAGCCACTCGGCTGACGGTGTCGTCGACCTGAACTGGGCTGCCGAGGTGCTG AAGGTGCAGAAGCGGCGCATCTATGACATCACCAACGTCCTTGAGGGCATCCAGCTCATT GCCAAGAAGTCCAAGAACCACATCCAGTGGCTGGGCAGCCACACCACAGTGGGCGTCGGC GGACGGCTTGAGGGGTTGACCCAGGACCTCCGACAGCTGCAGGAGAGCGAGCAGCAGCTG GACCACCTGATGAATATCTGTACTACGCAGCTGCGCCTGCTCTCCGAGGACACTGACAGC CAGCGCCTGGCCTACGTGACGTGTCAGGACCTTCGTAGCATTGCAGACCCTGCAGAGCAG ATGGTTATGGTGATCAAAGCCCCTCCTGAGACCCAGCTCCAAGCCGTGGACTCTTCGGAG AACTTTCAGATCTCCCTTAAGAGCAAACAAGGCCCGATCGATGTTTTCCTGTGCCCTGAG GAGACCGTAGGTGGGATCAGCCCTGGGAAGACCCCATCCCAGGAGGTCACTTCTAAGGAG GAGAACAGGGCCACTGACTCTGCCACCATAGTGTCACCACCACCATCATCTCCCCCCTCA TCCCTCACCACAGATCCCAGCCAGTCTCTACTCAGCCTGGAGCAAGAACCGCTGTTGTCC CGGATGGGCAGCCTGCGGGCTCCCGTGGACGAGGACCGCCTGTCCCCGCTGGTGGCGGCC GACTCGCTCCTGGAGCATGTGCGGGAGGACTTCTCCGGCCTCCTCCCTGAGGAGTTCATC AGCCTTTCCCCACCCCACGAGGCCCTCGACTACCACTTCGGCCTCGAGGAGGGCGAGGGC ATCAGAGACCTCTTCGACTGTGACTTTGGGGACCTCACCCCCCTGGATTTCTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_005225 |
| Insert Size | 2722 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This clone has been fully sequenced and found one SNP within the protein associated with this reference, NM_005225.2. The SNP changes amino acid from E to K. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_005225.2, NP_005216.1 |
| RefSeq Size | 2722 bp |
| RefSeq ORF | 1314 bp |
| Locus ID | 1869 |
| UniProt ID | Q01094 |
| Domains | E2F_TDP |
| Protein Families | Druggable Genome, Transcription Factors |
| Protein Pathways | Bladder cancer, Cell cycle, Chronic myeloid leukemia, Glioma, Melanoma, Non-small cell lung cancer, Pancreatic cancer, Pathways in cancer, Prostate cancer, Small cell lung cancer |
| Gene Summary | The protein encoded by this gene is a member of the E2F family of transcription factors. The E2F family plays a crucial role in the control of cell cycle and action of tumor suppressor proteins and is also a target of the transforming proteins of small DNA tumor viruses. The E2F proteins contain several evolutionally conserved domains found in most members of the family. These domains include a DNA binding domain, a dimerization domain which determines interaction with the differentiation regulated transcription factor proteins (DP), a transactivation domain enriched in acidic amino acids, and a tumor suppressor protein association domain which is embedded within the transactivation domain. This protein and another 2 members, E2F2 and E2F3, have an additional cyclin binding domain. This protein binds preferentially to retinoblastoma protein pRB in a cell-cycle dependent manner. It can mediate both cell proliferation and p53-dependent/independent apoptosis. [provided by RefSeq, Jul 2008] |
Citations (3)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
CDK8 regulates E2F1 transcriptional activity through S375 phosphorylation
,J Zhao, R Ramos & M Demma,
Oncogene doi:10.1038/onc.2012.364
[E2F1]
|
|
Silencing of NHE1 Attenuates PASMC Proliferation, Hypertrophy and Migration via E2F1
,Lunyin Yu and Charles A Hales,
Am. J. Respir. Cell Mol. Biol., Mar 2011; 10.1165/rcmb.2011-0032OC
[E2F1]
|
|
IKK alpha Regulates Estrogen-induced Cell Cycle Progression by Modulating E2F1 Expression
,Zheng Tu, Shashi Prajapati, Kyu-Jin Park, Nathan J. Kelly, Yumi Yamamoto, and Richard B. Gaynor,
J. Biol. Chem. 2006 Mar 10;281(10):6699-706.
[E2F1]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC208247 | E2F1 (Myc-DDK-tagged)-Human E2F transcription factor 1 (E2F1) |
CNY 5,488.00 |
|
| RC208247L1 | Lenti ORF clone of Human E2F transcription factor 1 (E2F1), Myc-DDK-tagged |
CNY 7,888.00 |
|
| RC208247L2 | Lenti ORF clone of Human E2F transcription factor 1 (E2F1), mGFP tagged |
CNY 7,888.00 |
|
| RC208247L3 | Lenti ORF clone of Human E2F transcription factor 1 (E2F1), Myc-DDK-tagged |
CNY 7,888.00 |
|
| RC208247L4 | Lenti ORF clone of Human E2F transcription factor 1 (E2F1), mGFP tagged |
CNY 7,888.00 |
|
| RG208247 | E2F1 (tGFP-tagged) - Human E2F transcription factor 1 (E2F1) |
CNY 7,088.00 |
