Angiopoietin 2 (ANGPT2) (NM_001118888) Human Untagged Clone

CAT#: SC318881

ANGPT2 (untagged)-Human angiopoietin 2 (ANGPT2), transcript variant 3



  "NM_001118888" in other vectors (4)

CNY 3,656.00

CNY 7,130.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
ANGPT2 mouse monoclonal antibody, clone OTI3H7 (formerly 3H7)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms AGPT2; ANG2; LMPHM10
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_001118888 edited
ATGTGGCAGATTGTTTTCTTTACTCTGAGCTGTGATCTTGTCTTGGCCGCAGCCTATAAC
AACTTTCGGAAGAGCATGGACAGCATAGGAAAGAAGCAATATCAGGTCCAGCATGGGTCC
TGCAGCTACACTTTCCTCCTGCCAGAGATGGACAACTGCCGCTCTTCCTCCAGCCCCTAC
GTGTCCAATGCTGTGCAGAGGGACGCGCCGCTCGAATACGATGACTCGGTGCAGAGGCTG
CAAGTGCTGGAGAACATCATGGAAAACAACACTCAGTGGCTAATGAAGGTATTAAATCAG
ACCACGAGACTTGAACTTCAGCTCTTGGAACACTCCCTCTCGACAAACAAATTGGAAAAA
CAGATTTTGGACCAGACCAGTGAAATAAACAAATTGCAAGATAAGAACAGTTTCCTAGAA
AAGAAGGTGCTAGCTATGGAAGACAAGCACATCATCCAACTACAGTCAATAAAAGAAGAG
AAAGATCAGCTACAGGTGTTAGTATCCAAGCAAAATTCCATCATTGAAGAACTAGAAAAA
AAAATAGTGACTGCCACGGTGAATAATTCAGTTCTTCAGAAGCAGCAACATGATCTCATG
GAGACAGTTAATAACTTACTGACTATGATGTCCACATCAAACTCTAAGGACCCCACTGTT
GCTAAAGAAGAACAAATCAGCTTCAGAGACTGTGCTGAAGTATTCAAATCAGGACACACC
ACGAATGGCATCTACACGTTAACATTCCCTAATTCTACAGAAGAGATCAAGGCCTACTGT
GACATGGAAGCTGGAGGAGGCGGGTGGACAATTATTCAGCGACGTGAGGATGGCAGCGTT
GATTTTCAGAGGACTTGGAAAGAATATAAAGTGGGATTTGGTAACCCTTCAGGAGAATAT
TGGCTGGGAAATGAGTTTGTTTCGCAACTGACTAATCAGCAACGCTATGTGCTTAAAATA
CACCTTAAAGACTGGGAAGGGAATGAGGCTTACTCATTGTATGAACATTTCTATCTCTCA
AGTGAAGAACTCAATTATAGGATTCACCTTAAAGGACTTACAGGGACAGCCGGCAAAATA
AGCAGCATCAGCCAACCAGGAAATGATTTTAGCACAAAGGATGGAGACAACGACAAATGT
ATTTGCAAATGTTCACAAATGCTAACAGGAGGCTGGTGGTTTGATGCATGTGGTCCTTCC
AACTTGAACGGAATGTACTATCCACAGAGGCAGAACACAAATAAGTTCAACGGCATTAAA
TGGTACTACTGGAAAGGCTCAGGCTATTCGCTCAAGGCCACAACCATGATGATCCGACCA
GCAGATTTCTAA
Restriction Sites Please inquire     
ACCN NM_001118888
Insert Size 5000 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001118888.1, NP_001112360.1
RefSeq Size 5114 bp
RefSeq ORF 1335 bp
Locus ID 285
UniProt ID O15123
Protein Families Druggable Genome, Secreted Protein
Gene Summary This gene belongs to the angiopoietin family of growth factors. The protein encoded by this gene is an antagonist of angiopoietin 1, and both angiopoietin 1 and angiopoietin 2 are ligands for the endothelial TEK receptor tyrosine kinase. Angiopoietin 2 is upregulated in multiple inflammatory diseases and is implicated in the direct control of inflammation-related signaling pathways. The encoded protein affects angiogenesis during embryogenesis and tumorigenesis, disrupts the vascular remodeling ability of angiopoietin 1, and may induce endothelial cell apoptosis. This gene serves a prognostic biomarker for acute respiratory distress syndrome. [provided by RefSeq, Aug 2020]
Transcript Variant: This variant (3) lacks an alternate in-frame exon compared to variant 1, resulting in an isoform (c) that has the same N- and C-termini but is shorter compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...