C11ORF67 (AAMDC) (NM_024684) Human Untagged Clone

CAT#: SC319071

AAMDC (untagged)-Human chromosome 11 open reading frame 67 (C11orf67)



  "NM_024684" in other vectors (4)

CNY 1,200.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
C11orf67 (AAMDC) mouse monoclonal antibody, clone OTI1G1 (formerly 1G1)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C11orf67; CK067; PTD015
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_024684.2 CCGAAGCAGCGCTGGGAGCGTAAGTGCGGGCAGAGCACTGCGCCGTTTGGGAACGCAACT
TTGAGGAGACAGTGCGGTGGACTTCAGTGAAGTTCCTTATGACTTCCCCTGAAATTGCTT
CCTTATCATGGGGGCAAATGAAAGTAAAAGGCTCTAATACAACCTATAAGGACTGCAAAG
TATGGCCAGGGGGTAGTCGGACTTGGGATTGGAGAGAAACAGGAACTGAGCATTCTCCTG
GTGTGCAGCCTGCAGATGTGAAGGAAGTTGTTGAGAAGGGTGTACAGACTCTTGTGATTG
GCCGAGGGATGAGTGAGGCCTTGAAGGTGCCTTCATCAACTGTGGAGTACCTCAAGAAAC
ATGGCATTGATGTGCGGGTCCTCCAGACAGAGCAGGCAGTGAAGGAGTATAATGCCTTGG
TTGCCCAAGGGGTCAGGGTGGGAGGTGTCTTCCATTCCACCTGCTGATGGAGCCTTAAGA
GGAGAATAAATCACTAAGTGCCTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_024684
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_024684.2, NP_078960.1
RefSeq Size 557 bp
RefSeq ORF 369 bp
Locus ID 28971
UniProt ID Q9H7C9
Gene Summary May play a role in preadipocyte differentiation and adipogenesis.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) differs in the 5' UTR and has an alternate exon in place of the last two exons compared to variant 1. The resulting isoform (c) has a shorter and distinct C-terminus compared to isoform a. Variants 3, 4, 5, and 6 all encode the same isoform (c).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...