United States
Germany
Japan
United Kingdom
China
Cardiac Troponin T (TNNT2) (NM_001001431) Human Untagged Clone
CAT＃: SC319089
TNNT2 (untagged)-Human troponin T type 2 (cardiac) (TNNT2), transcript variant 3
CNY 2,400.00
CNY 6,270.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CMD1D; CMH2; CMPD2; cTnT; LVNC6; RCM3; TnTC |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_001001431.1
CTGAGCAGACGCCTCCAGGATCTGTCGGCAGCTGCTGTTCTGAGGGAGAGCAGAGACCAT
GTCTGACATAGAAGAGGTGGTGGAAGAGTACGAGGAGGAGGAGCAGGAAGAAGCAGCTGT TGAAGAGCAGGAGGAGGCAGCGGAAGAGGATGCTGAAGCAGAGGCTGAGACCGAGGAGAC CAGGGCAGAAGAAGATGAAGAAGAAGAGGAAGCAAAGGAGGCTGAAGATGGCCCAATGGA GGAGTCCAAACCAAAGCCCAGGTCGTTCATGCCCAACTTGGTGCCTCCCAAGATCCCCGA TGGAGAGAGAGTGGACTTTGATGACATCCACCGGAAGCGCATGGAGAAGGACCTGAATGA GTTGCAGGCGCTGATCGAGGCTCACTTTGAGAACAGGAAGAAAGAGGAGGAGGAGCTCGT TTCTCTCAAAGACAGGATCGAGAGACGTCGGGCAGAGCGGGCCGAGCAGCAGCGCATCCG GAATGAGCGGGAGAAGGAGCGGCAGAACCGCCTGGCTGAAGAGAGGGCTCGACGAGAGGA GGAGGAGAACAGGAGGAAGGCTGAGGATGAGGCCCGGAAGAAGAAGGCTTTGTCCAACAT GATGCATTTTGGGGGTTACATCCAGAAGACAGAGCGGAAAAGTGGGAAGAGGCAGACTGA GCGGGAAAAGAAGAAGAAGATTCTGGCTGAGAGGAGGAAGGTGCTGGCCATTGACCACCT GAATGAAGATCAGCTGAGGGAGAAGGCCAAGGAGCTGTGGCAGAGCATCTATAACTTGGA GGCAGAGAAGTTCGACCTGCAGGAGAAGTTCAAGCAGCAGAAATATGAGATCAATGTTCT CCGAAACAGGATCAACGATAACCAGAAAGTCTCCAAGACCCGCGGGAAGGCTAAAGTCAC CGGGCGCTGGAAATAGAGCCTGGCCTCCTTCACCAAAGATCTGCTCCTCGCTCGCACCTG CCTCCGGCCTGCACTCCCCCAGTTCCCGGGCCCTCCTGGGCACCCCAGGCAGCTCCTGTT TGGAAATGGGGAGCTGGCCTAGGTGGGAGCCACCACTCCTGCCTGCCCCCACACCCACTC CACACCAGTAATAAAAAGCCACCACACAAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_001001431 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001001431.1, NP_001001431.1 |
| RefSeq Size | 1123 bp |
| RefSeq ORF | 858 bp |
| Locus ID | 7139 |
| UniProt ID | P45379 |
| Protein Families | Druggable Genome |
| Protein Pathways | Cardiac muscle contraction, Dilated cardiomyopathy, Hypertrophic cardiomyopathy (HCM) |
| Gene Summary | The protein encoded by this gene is the tropomyosin-binding subunit of the troponin complex, which is located on the thin filament of striated muscles and regulates muscle contraction in response to alterations in intracellular calcium ion concentration. Mutations in this gene have been associated with familial hypertrophic cardiomyopathy as well as with dilated cardiomyopathy. Transcripts for this gene undergo alternative splicing that results in many tissue-specific isoforms, however, the full-length nature of some of these variants has not yet been determined. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (3) lacks multiple in-frame exons, compared to variant 5. It encodes a shorter isoform (3) compared to isoform 5. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC201218 | TNNT2 (Myc-DDK-tagged)-Human troponin T type 2 (cardiac) (TNNT2), transcript variant 3 |
CNY 2,400.00 |
|
| RC201218L1 | Lenti ORF clone of Human troponin T type 2 (cardiac) (TNNT2), transcript variant 3, Myc-DDK-tagged |
CNY 4,800.00 |
|
| RC201218L2 | Lenti ORF clone of Human troponin T type 2 (cardiac) (TNNT2), transcript variant 3, mGFP tagged |
CNY 5,890.00 |
|
| RC201218L3 | Lenti ORF clone of Human troponin T type 2 (cardiac) (TNNT2), transcript variant 3, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC201218L4 | Lenti ORF clone of Human troponin T type 2 (cardiac) (TNNT2), transcript variant 3, mGFP tagged |
CNY 5,890.00 |
|
| RG201218 | TNNT2 (tGFP-tagged) - Human troponin T type 2 (cardiac) (TNNT2), transcript variant 3 |
CNY 4,000.00 |
其它Cardiac Troponin T产品
