RSU1 (NM_012425) Human Untagged Clone
CAT#: SC319710
RSU1 (untagged)-Human Ras suppressor protein 1 (RSU1), transcript variant 1
CNY 2,400.00
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | RSP-1 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF within SC319710 sequence for NM_012425 edited (data generated by NextGen Sequencing)
ATGTCCAAGTCTCTGAAGAAGTTGGTGGAGGAGAGCCGGGAGAAGAACCAGCCCGAGGTGGACATGAGTG ACCGGGGCATCTCCAACATGCTGGATGTCAACGGCCTCTTTACCTTATCCCATATCACACAACTGGTCCT CAGCCATAACAAGCTAACAATGGTGCCACCGAACATCGCAGAACTGAAGAATTTGGAGGTGCTCAACTTT TTTAATAACCAAATCGAGGAGCTGCCCACACAGATCAGTAGCCTTCAGAAACTCAAACACCTGAACCTTG GCATGAACAGGCTGAACACTTTGCCACGAGGCTTCGGCTCCCTGCCAGCTCTTGAGGTTCTGGACTTGAC GTACAACAACTTGAGCGAAAATTCTCTTCCTGGAAACTTCTTCTACCTGACCACCCTGCGTGCACTCTAT CTAAGTGACAACGATTTTGAAATCCTGCCGCCAGATATTGGGAAGCTCACAAAGTTGCAGATACTCAGCC TTAGGGATAACGACCTGATCTCGCTGCCTAAGGAAATCGGGGAGCTTACCCAGCTTAAAGAGCTCCACAT TCAGGGGAACCGCCTCACCGTTCTGCCCCCAGAACTAGGAAACTTGGATTTAACTGGCCAGAAGCAGGTA TTCAAAGCAGAGAACAATCCCTGGGTGACCCCCATTGCAGACCAGTTCCAGCTTGGCGTGTCCCATGTTT TTGAGTATATCCGTTCTGAGACATACAAATACCTCTACGGCAGACACATGCAGGCCAACCCAGAACCACC GAAGAAGAATAATGACAAATCGAAAAAGATCAGCCGGAAACCCCTGGCAGCCAAGAACAGATAA Clone variation with respect to NM_012425.3 |
Restriction Sites | Please inquire |
ACCN | NM_012425 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_012425.3, NP_036557.1 |
RefSeq Size | 3769 bp |
RefSeq ORF | 834 bp |
Locus ID | 6251 |
UniProt ID | Q15404 |
Domains | LRR, LRR_TYP, LRR_PS |
Protein Families | Druggable Genome |
Gene Summary | This gene encodes a protein that is involved in the Ras signal transduction pathway, growth inhibition, and nerve-growth factor induced differentiation processes, as determined in mouse and human cell line studies. In mouse, the encoded protein was initially isolated based on its ability to inhibit v-Ras transformation. Multiple alternatively spliced transcript variants for this gene have been reported; one of these variants was found only in glioma tumors. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) encodes the longer isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC203334 | RSU1 (Myc-DDK-tagged)-Human Ras suppressor protein 1 (RSU1), transcript variant 1 |
CNY 3,990.00 |
|
RC203334L3 | Lenti-ORF clone of RSU1 (Myc-DDK-tagged)-Human Ras suppressor protein 1 (RSU1), transcript variant 1 |
CNY 5,890.00 |
|
RC203334L4 | Lenti-ORF clone of RSU1 (mGFP-tagged)-Human Ras suppressor protein 1 (RSU1), transcript variant 1 |
CNY 5,890.00 |
|
RG203334 | RSU1 (tGFP-tagged) - Human Ras suppressor protein 1 (RSU1), transcript variant 1 |
CNY 4,240.00 |