United States
Germany
Japan
United Kingdom
China
MAST4 (NM_198828) Human Untagged Clone
CAT＃: SC319866
MAST4 (untagged)-Human microtubule associated serine/threonine kinase family member 4 (MAST4), transcript variant 2
CNY 2,400.00
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_198828.1
GCAGCGCGGGAGCACAGTGGAGCGCAGATCGCGGACCCGAGCGGGCATGTCCCCGCGCGC
GGGAGCCTCCGTTTGCGGCCGGGCCCGGGCGGCTGTGAACTTAGCAGCGGGCTCCTGCGG CCCCGTCACTGCCATGTAGTCGCTGGCGGGGCTCCCTGCAGCCCGGGAGCGGCAGTGCCA GTGAGCCTGAGCCCAGGAGCCCGCGTCTTCCCCGGGAGGCGCTGAGTGCGCGCCGCGCCC CCGCCGCTCGGGAGGCACTTTGGGCCAGACAGGGAAATGGGGGAGAAAGTTTCGGAGGCG CCAGAGCCGGTGCCCCGCGGCTGCAGTGGCCACGGCAGCCGGACTCCAGCCTCTGCGCTG GTCGCCGCGTCCTCTCCGGGTGCTTCCTCGGCCGAGTCCTCCTCGGGCTCAGAAACTCTG TCGGAGGAAGGGGAGCCCGGCGGCTTCTCCAGAGAGCATCAGCCGCCGCCGCCGCCGCCG TTGGGAGGCACCCTGGGCGCCCGGGCGCCCGCCGCGTGGGCTCCGGCAAGCGTGCTGCTG GAGCGCGGAGTCCTTGCGCTGCCGCCGCCGCTTCCCGGAGGAGCTGTGCCGCCCGCGCCC CGGGGCAGCAGCGCGTCCCAGGAGGAGCAGGACGAGGAGCTTGACCACATATTATCCCCT CCACCCATGCCGTTTCGGAAATGCAGCAACCCAGATGTGGCTTCTGGCCCTGGAAAATCA CTGAAGTATAAAAGACAGCTGAGTGAGGATGGAAGACAGCTAAGGCGAGGGAGCCTGGGA GGAGCCCTGACTGGGAGGTACCTTCTTCCAAACCCGGTGGCGGGACAGGCCTGGCCGGCC TCTGCAGAGACGTCCAACCTCGTGCGCATGCGCAGCCAGGCCCTGGGCCAGTCGGCGCCC TCGCTCACCGCCAGCCTGAAGGAGCTGAGTCTCCCCAGAAGAGGAAGTTTGATAGATTCC CAGAAGTGGAATTGCTTGGTCAAACGCCCTGTGTGTCCAAATGCTGGGAGAACATCACCC CTTGGATGAATTGCCACCACATTAAATAAAACATATCCAAAGCTCAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_198828 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_198828.1, NP_942123.1 |
| RefSeq Size | 1105 bp |
| RefSeq ORF | 753 bp |
| Locus ID | 375449 |
| UniProt ID | O15021 |
| Protein Families | Druggable Genome, Protein Kinase |
| Gene Summary | This gene encodes a member of the microtubule-associated serine/threonine protein kinases. The proteins in this family contain a domain that gives the kinase the ability to determine its own scaffold to control the effects of their kinase activities. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014] Transcript Variant: This variant (2) uses a distinct 3' coding region and 3' UTR, compared to variant 3. The resulting isoform (b) has a substantially shorter and distinct C-terminus, compared to isoform c. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC207706 | MAST4 (Myc-DDK-tagged)-Human microtubule associated serine/threonine kinase family member 4 (MAST4), transcript variant 2 |
CNY 2,400.00 |
|
| RC207706L1 | Lenti ORF clone of Human microtubule associated serine/threonine kinase family member 4 (MAST4), transcript variant 2, Myc-DDK-tagged |
CNY 4,800.00 |
|
| RC207706L2 | Lenti ORF clone of Human microtubule associated serine/threonine kinase family member 4 (MAST4), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RC207706L3 | Lenti ORF clone of Human microtubule associated serine/threonine kinase family member 4 (MAST4), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC207706L4 | Lenti ORF clone of Human microtubule associated serine/threonine kinase family member 4 (MAST4), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RG207706 | MAST4 (tGFP-tagged) - Human microtubule associated serine/threonine kinase family member 4 (MAST4), transcript variant 2 |
CNY 4,370.00 |
