United States
Germany
Japan
United Kingdom
China
DLX5 (NM_005221) Human Untagged Clone
CAT＃: SC320170
DLX5 (untagged)-Human distal-less homeobox 5 (DLX5)
CNY 3,600.00
| Cited in 1 publication. |
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | SHFM1; SHFM1D |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_005221.5
CGGAGACAGAGACTTCACGACTCCCAGTCTCCTCCTCGCCGCGGCCGCCGCCTCCTCCTT
CTCTCCTCCTCCTCTTCCTCCTCCTCCCTCGCTCCCACAGCCATGTCTGCTTAGACCAGA GCAGCCCCACAGCCAACTAGGGCAGCTGCCGCCGCCACAACAGCAAGGACAGCCGCTGCC GCCGCCCGTGAGCGATGACAGGAGTGTTTGACAGAAGGGTCCCCAGCATCCGATCCGGCG ACTTCCAAGCTCCGTTCCAGACGTCCGCAGCTATGCACCATCCGTCTCAGGAATCGCCAA CTTTGCCCGAGTCTTCAGCTACCGATTCTGACTACTACAGCCCTACGGGGGGAGCCCCGC ACGGCTACTGCTCTCCTACCTCGGCTTCCTATGGCAAAGCTCTCAACCCCTACCAGTATC AGTATCACGGCGTGAACGGCTCCGCCGGGAGCTACCCAGCCAAAGCTTATGCCGACTATA GCTACGCTAGCTCCTACCACCAGTACGGCGGCGCCTACAACCGCGTCCCAAGCGCCACCA ACCAGCCAGAGAAAGAAGTGACCGAGCCCGAGGTGAGAATGGTGAATGGCAAACCAAAGA AAGTTCGTAAACCCAGGACTATTTATTCCAGCTTTCAGCTGGCCGCATTACAGAGAAGGT TTCAGAAGACTCAGTACCTCGCCTTGCCGGAACGCGCCGAGCTGGCCGCCTCGCTGGGAT TGACACAAACACAGGTGAAAATCTGGTTTCAGAACAAAAGATCCAAGATCAAGAAGATCA TGAAAAACGGGGAGATGCCCCCGGAGCACAGTCCCAGCTCCAGCGACCCAATGGCGTGTA ACTCGCCGCAGTCTCCAGCGGTGTGGGAGCCCCAGGGCTCGTCCCGCTCGCTCAGCCACC ACCCTCATGCCCACCCTCCGACCTCCAACCAGTCCCCAGCGTCCAGCTACCTGGAGAACT CTGCATCCTGGTACACAAGTGCAGCCAGCTCAATCAATTCCCACCTGCCGCCGCCGGGCT CCTTACAGCACCCGCTGGCGCTGGCCTCCGGGACACTCTATTAGATGGGCTGCTCTCTCT TACTCTCTTTTTTGGGACTACTGTGTTTTGCTGTTCTAGAAAATCATAAAGAAAGGAATT CATATGGGGAAGTTCGGAAAACTGAAAAAGATTCATGTGTAAAGCTTTTTTTTGCATGTA AGTTATTGCATTTCAAAAGACCCCCCCTTTTTTTACAGAGGACTTTTTTTGCGCAACTGT GGACACTTTCAATGGTGCCTTGAAATCTATGACCTCAACTTTTCAAAAGACTTTTTTCAA TGTTATTTTAGCCATGTAAATAAGTGTAGATAGAGGAATTAAACTGTATATTCTGGATAA ATAAAATTATTTCGACCATGAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_005221 |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_005221.5, NP_005212.1 |
| RefSeq Size | 1424 bp |
| RefSeq ORF | 870 bp |
| Locus ID | 1749 |
| UniProt ID | P56178 |
| Domains | homeobox |
| Protein Families | ES Cell Differentiation/IPS, Transcription Factors |
| Gene Summary | This gene encodes a member of a homeobox transcription factor gene family similiar to the Drosophila distal-less gene. The encoded protein may play a role in bone development and fracture healing. Mutation in this gene, which is located in a tail-to-tail configuration with another member of the family on the long arm of chromosome 7, may be associated with split-hand/split-foot malformation. [provided by RefSeq, Jul 2008] |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Regulation of the Bone-restricted IFITM-like (Bril) Gene Transcription by Sp and Gli Family Members and CpG Methylation
,Bahar Kasaai, Marie-Hélène Gaumond, and Pierre Moffatt,
J. Biol. Chem., May 2013; 288: 13278 - 13294.
,PubMed ID 23530031
[DLX5]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC202525 | DLX5 (Myc-DDK-tagged)-Human distal-less homeobox 5 (DLX5) |
CNY 3,600.00 |
|
| RC202525L1 | Lenti ORF clone of Human distal-less homeobox 5 (DLX5), Myc-DDK-tagged |
CNY 6,000.00 |
|
| RC202525L2 | Lenti ORF clone of Human distal-less homeobox 5 (DLX5), mGFP tagged |
CNY 6,000.00 |
|
| RC202525L3 | Lenti ORF clone of Human distal-less homeobox 5 (DLX5), Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC202525L4 | Lenti ORF clone of Human distal-less homeobox 5 (DLX5), mGFP tagged |
CNY 6,000.00 |
|
| RG202525 | DLX5 (tGFP-tagged) - Human distal-less homeobox 5 (DLX5) |
CNY 5,200.00 |
