TIGAR (NM_020375) Human Untagged Clone
CAT#: SC320794
C12orf5 (untagged)-Human chromosome 12 open reading frame 5 (C12orf5)
CNY 2,400.00
CNY 2,950.00
Cited in 3 publications. |
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | C12orf5; FR2BP |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_020375.2
GCGGCGCGGGGCCACCGACGGGACGCGGCTCCGGGAACATGGCTCGCTTCGCTCTGACTG
TTGTCCGGCATGGAGAAACAAGATTTAACAAGGAGAAAATAATCCAAGGACAAGGAGTAG ATGAACCTCTTTCAGAAACTGGATTTAAACAAGCAGCAGCTGCTGGTATATTTCTGAATA ATGTGAAGTTTACTCATGCTTTCTCCAGTGATCTCATGAGGACAAAGCAGACCATGCATG GAATTTTGGAGAGAAGCAAATTTTGCAAAGATATGACGGTAAAGTATGACTCAAGACTTC GGGAAAGGAAATACGGGGTTGTAGAAGGCAAAGCGCTAAGTGAGCTGAGGGCCATGGCCA AAGCAGCCAGGGAAGAGTGCCCTGTGTTTACACCGCCCGGAGGAGAGACGCTGGACCAGG TGAAAATGCGTGGAATAGACTTTTTTGAATTTCTTTGTCAACTAATCCTGAAAGAAGCGG ATCAAAAAGAACAGTTTTCCCAAGGATCTCCAAGCAACTGTCTGGAAACTTCTTTGGCAG AGATATTTCCTTTAGGAAAAAATCACAGCTCTAAAGTTAATTCAGACAGCGGTATTCCAG GATTAGCAGCCAGTGTCTTAGTTGTGAGTCACGGTGCTTACATGAGAAGTCTGTTTGATT ATTTTCTGACTGACCTTAAGTGTTCCTTACCAGCCACTCTGAGCAGATCTGAACTTATGT CAGTCACTCCCAATACAGGGATGAGTCTCTTTATCATAAACTTTGAGGAAGGAAGAGAAG TTAAACCAACGGTTCAGTGTATTTGTATGAACCTACAGGATCATCTAAATGGACTGACTG AAACTCGCTAAGGTTAAATCTGCATCAAAATCTAACCATTTTGAGCCTCTGAAGGGAGTG CCATTGGCTTTATTTACTTCTCTCCTCTGCTAGTTCTGATTTGGAAACAGTTAAAAGCCA ATTTTTAGCTCCAGTGGAACCATAGCCACATAAAACTTTAATGGACAACCATATAGAATT AACTTATTTTGTCTAAGTACAGTTGGCATTTTCCAGAATAATTTTACCACCCTGCTAGAT GTCATCTCTGGATTGCACATGGATGATGAAGGAACTCAGCATTGAAAGTTGGGGGATTAA TAACCTTGTTACAACGGTTTCTTTTTCATTTTAGCCTATTTTAATGGCTATTGGTAAGAT ACTGTATGTTTTTAGTATCTCATCCAGTGCTTAGAAGAAAGAATGGTTTATAATTCCCAG TACATGTTTATATTGACTGTGTTATATTTTTAAATCCTTTAAATAAAAAATCCTTATAAG TTTATGTAAAGCAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_020375 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_020375.2, NP_065108.1 |
RefSeq Size | 8237 bp |
RefSeq ORF | 813 bp |
Locus ID | 57103 |
UniProt ID | Q9NQ88 |
Domains | PGAM |
Gene Summary | This gene is regulated as part of the p53 tumor suppressor pathway and encodes a protein with sequence similarity to the bisphosphate domain of the glycolytic enzyme that degrades fructose-2,6-bisphosphate. The protein functions by blocking glycolysis and directing the pathway into the pentose phosphate shunt. Expression of this protein also protects cells from DNA damaging reactive oxygen species and provides some protection from DNA damage-induced apoptosis. The 12p13.32 region that includes this gene is paralogous to the 11q13.3 region. [provided by RefSeq, Jul 2008] |
Citations (3)
The use of this cDNA Clones has been cited in the following citations: |
---|
Four key steps control glycolytic flux in mammalian cells
,null,
Cell systems
,PubMed ID 29960885
[TIGAR]
|
The fructose-2,6-bisphosphatase TIGAR suppresses NF-κB signaling by directly inhibiting the linear ubiquitin assembly complex LUBAC
,null,
The Journal of Biological Chemistry
,PubMed ID 29650758
[TIGAR]
|
Inhibition of c-Met downregulates TIGAR expression and reduces NADPH production leading to cell death
,V W Y Lui, E Y L Wong, K Ho, P K S Ng, C P Y Lau, S K W Tsui, C-M Tsang, S-W Tsao, S H Cheng, M H L Ng, et al,
Oncogene (8 November 2010) doi:10.1038/onc.2010.490 Short Communication
[TIGAR]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC204087 | C12orf5 (Myc-DDK-tagged)-Human chromosome 12 open reading frame 5 (C12orf5) |
CNY 2,400.00 |
|
RC204087L1 | Lenti ORF clone of Human chromosome 12 open reading frame 5 (C12orf5), Myc-DDK-tagged |
CNY 4,800.00 |
|
RC204087L2 | Lenti ORF clone of Human chromosome 12 open reading frame 5 (C12orf5), mGFP tagged |
CNY 5,890.00 |
|
RC204087L3 | Lenti ORF clone of Human chromosome 12 open reading frame 5 (C12orf5), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC204087L4 | Lenti ORF clone of Human chromosome 12 open reading frame 5 (C12orf5), mGFP tagged |
CNY 5,890.00 |
|
RG204087 | C12orf5 (tGFP-tagged) - Human chromosome 12 open reading frame 5 (C12orf5) |
CNY 4,000.00 |
|
SC113108 | C12orf5 (untagged)-Human chromosome 12 open reading frame 5 (C12orf5) |
CNY 2,400.00 |