MRPS18C (NM_016067) Human Untagged Clone
CAT#: SC320819
MRPS18C (untagged)-Human mitochondrial ribosomal protein S18C (MRPS18C), nuclear gene encoding mitochondrial protein
CNY 1,200.00
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CGI-134; MRP-S18-1; MRP-S18-c; MRPS18-1; mrps18-c; S18mt-c |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_016067 edited
GATTTGGAACGAAAGGGAGTGGAAGAAACGCGGAACCATGGCCGCTGTGGTTGCTGTTTG CGGTGGTCTAGGGAGGAAGAAGTTGACACACTTGGTAACGGCTGCTGTCAGCCTTACACA TCCCGGGACTCACACGGTGCTTTGGAGAAGAGGTTGTTCACAACAGGTATCCAGCAATGA GGACCTGCCCATTTCAATGGAAAATCCTTATAAAGAACCTCTTAAGAAATGTATCTTGTG TGGAAAGCATGTAGATTATAAGAATGTACAGCTTTTGTCCCAGTTTGTTTCTCCATTTAC TGGATGCATTTATGGAAGGCACATTACAGGTCTTTGTGGGAAGAAACAGAAAGAAATCAC AAAAGCAATTAAGAGAGCTCAAATAATGGGGTTTATGCCAGTTACATACAAGGATCCTGC ATATCTCAAGGACCCTAAAGTTTGTAACATCAGATATCGGGAATAAATTCTATCACGTTA CCACTAATAAACTTATTTTACAGTAAGTGGTTGTATGATGCCAATACTGACTCAAACCAA CCTTTGGATAGAAAAGTGTTTGAGGAGTGAGGTAAAGAATGACACTTCCCCTTCATACCA ATGTCCATTAAGCAGATTGCTTATTTAAAATGTTAACACTCATCACATTTTATCTATGTT GAATAAAAGTGGTTCTGTGTGATTGTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_016067 |
Insert Size | 700 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_016067.1. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_016067.1, NP_057151.1 |
RefSeq Size | 1014 bp |
RefSeq ORF | 429 bp |
Locus ID | 51023 |
UniProt ID | Q9Y3D5 |
Domains | Ribosomal_S18 |
Gene Summary | Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that belongs to the ribosomal protein S18P family. The encoded protein is one of three that has significant sequence similarity to bacterial S18 proteins. The primary sequences of the three human mitochondrial S18 proteins are no more closely related to each other than they are to the prokaryotic S18 proteins. Pseudogenes corresponding to this gene are found on chromosomes 8p, 12p, 15q, and 22q. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC202659 | MRPS18C (Myc-DDK-tagged)-Human mitochondrial ribosomal protein S18C (MRPS18C), nuclear gene encoding mitochondrial protein |
CNY 1,200.00 |
|
RC202659L3 | Lenti ORF clone of Human mitochondrial ribosomal protein S18C (MRPS18C), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC202659L4 | Lenti ORF clone of Human mitochondrial ribosomal protein S18C (MRPS18C), nuclear gene encoding mitochondrial protein, mGFP tagged |
CNY 5,890.00 |
|
RG202659 | MRPS18C (tGFP-tagged) - Human mitochondrial ribosomal protein S18C (MRPS18C), nuclear gene encoding mitochondrial protein |
CNY 4,370.00 |
|
SC310669 | MRPS18C (untagged)-Human mitochondrial ribosomal protein S18C (MRPS18C), nuclear gene encoding mitochondrial protein |
CNY 1,200.00 |
其它MRPS18C产品