NT5C (NM_014595) Human Untagged Clone
CAT#: SC320933
NT5C (untagged)-Human 5', 3'-nucleotidase, cytosolic (NT5C)
CNY 2,400.00
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | cdN; DNT; dNT-1; DNT1; HEL74; P5N2; PN-I; PN-II; UMPH2 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_014595.1
GCCGAGCCCGCGCCCCCCAGACCCCGAGAGCTCGCAGCTCCGGCCCGGCGGCGATGGCGC
GGAGCGTGCGCGTGCTGGTGGACATGGACGGCGTCCTGGCCGACTTCGAGGCCGGCCTCC TGCGGGGCTTCCGCCGCCGCTTCCCTGAGGAGCCGCACGTGCCGCTGGAGCAGCGCCGCG GCTTCCTGGCCCGCGAGCAGTACCGCGCCCTGCGGCCCGACCTGGCGGATAAAGTGGCCA GTGTGTACGAAGCCCCGGGCTTTTTCCTGGACCTGGAGCCCATCCCGGGAGCCTTGGACG CTGTGCGGGAGATGAACGACCTACCGGACACGCAGGTCTTCATCTGCACCAGCCCCCTGC TGAAGTACCACCACTGTGTGGGTGAGAAGTACCGCTGGGTGGAGCAGCACCTGGGGCCCC AGTTCGTAGAACGAATTATCCTGACAAGGGACAAGACGGTGGTCTTGGGGGACCTGCTCA TTGATGACAAGGACACAGTTCGAGGCCAGGAGGAGACCCCAAGCTGGGAGCACATCTTGT TCACCTGCTGCCACAATCGGCACCTGGTCCTGCCCCCGACAAGGAGACGGCTGCTCTCCT GGAGTGACAACTGGAGGGAGATCTTAGATAGCAAGCGCGGAGCTGCGCAGCGGGAATGAG CGGGGATGCCGCGGGCAGCAGCTGGAGCTAAAGGAAGGGCAGGCCCACAGGGGCCACCGC AGAGCCGAGTCGGGGCGGCATCGTGCTGGTGCCTCTGGCCCCGTGGAGTGGAGCAGGCAG ATACCGTTAAGCGCTGTGCTACCGGGCCCCAGGCCCAGCCACCCGGTACCTCCCGAGAGG CTGTCCCTGGACCCTGGCTGGCATGGAAATACAGTGGGAAAACCAGTCGGGACCTTTAAT AAAAGACCTTGGCTTTCTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_014595 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_014595.1, NP_055410.1 |
RefSeq Size | 970 bp |
RefSeq ORF | 606 bp |
Locus ID | 30833 |
UniProt ID | Q8TCD5 |
Protein Families | Transcription Factors |
Protein Pathways | Metabolic pathways, Nicotinate and nicotinamide metabolism, Purine metabolism, Pyrimidine metabolism |
Gene Summary | This gene encodes a nucleotidase that catalyzes the dephosphorylation of the 5' deoxyribonucleotides (dNTP) and 2'(3')-dNTP and ribonucleotides, but not 5' ribonucleotides. Of the different forms of nucleotidases characterized, this enzyme is unique in its preference for 5'-dNTP. It may be one of the enzymes involved in regulating the size of dNTP pools in cells. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Nov 2011] Transcript Variant: This variant (1) represents the predominant transcript, and encodes the longer isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC204265 | NT5C (Myc-DDK-tagged)-Human 5', 3'-nucleotidase, cytosolic (NT5C) |
CNY 2,400.00 |
|
RC204265L1 | Lenti ORF clone of Human 5', 3'-nucleotidase, cytosolic (NT5C), Myc-DDK-tagged |
CNY 4,800.00 |
|
RC204265L2 | Lenti ORF clone of Human 5', 3'-nucleotidase, cytosolic (NT5C), mGFP tagged |
CNY 5,890.00 |
|
RC204265L3 | Lenti ORF clone of Human 5', 3'-nucleotidase, cytosolic (NT5C), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC204265L4 | Lenti ORF clone of Human 5', 3'-nucleotidase, cytosolic (NT5C), mGFP tagged |
CNY 5,890.00 |
|
RG204265 | NT5C (tGFP-tagged) - Human 5', 3'-nucleotidase, cytosolic (NT5C) |
CNY 4,000.00 |
|
SC114947 | NT5C (untagged)-Human 5', 3'-nucleotidase, cytosolic (NT5C) |
CNY 2,400.00 |